--- title: "Quickstart Guide to ggseqalign" author: - name: Simeon Lim Rossmann affiliation: Norwegian University of Life Sciences (NMBU) email: simeon.rossmann@nmbu.no package: ggseqalign output: BiocStyle::html_document abstract: | Provides basic instructions to create minimal visualizations of pairwise alignments from various inputs. vignette: | %\VignetteIndexEntry{Quickstart Guide to ggseqalign} %\VignetteEncoding{UTF-8} %\VignetteEngine{knitr::rmarkdown} editor_options: markdown: wrap: 72 --- <img src="../inst/hexlogo/hexlogo.png" alt="ggseqalign hexlogo" width="500"/> # Introduction Showing small differences between two long strings, such as DNA or AA sequences is challenging, especially in R. Typically, DNA or AA sequence alignments show all characters in a sequence. The package `r Biocpkg("ggmsa")` does this really well and is compatible with ggplot2. However, this is not viable for sequences over a certain length.\ Alternatively, top level visualizations may, for example, represent degree of variation over the length in a line plot, making it possible to gauge how strongly sequences differ, but not the quality of the difference. The intention with this package is to provide a way to visualize sequence alignments over the whole length of arbitrarily long sequences without losing the ability to show small differences, see figure \@ref(fig:showcase). ```{r showcase, fig.cap="Example of ggseqalign visualization. Showcase of the package's capability to highlight differences between 2000 bp long DNA sequences.", echo=FALSE, warning=FALSE, message=FALSE} ### This chunk dynamically creates fig:showcase but is hidden in the vignette. # It is meant to give an initial impression of a real use case without # presenting overwhelming code at the start. This chunk is recreated in # 'ggplot-mod' in its entirety aside from the global figure output setting. library(Biostrings) library(ggseqalign) library(ggplot2) knitr::opts_chunk$set(fig.dim = c(6, 4)) dna <- readDNAStringSet(system.file("extdata", "dm3_upstream2000.fa.gz", package = "Biostrings" )) q <- dna[2:4] s <- dna[5] q[1] <- as( replaceLetterAt(q[[1]], c(5, 200, 400), "AGC"), "DNAStringSet" ) q[2] <- as( c(substr(q[[2]], 300, 1500), substr(q[[2]], 1800, 2000)), "DNAStringSet" ) q[3] <- as( replaceAt( q[[3]], 1500, paste(rep("A", 1000), collapse = "") ), "DNAStringSet" ) names(q) <- c("mismatches", "deletions", "insertion") names(s) <- "reference" plot_sequence_alignment(alignment_table(q, s)) + theme(text = element_text(size = 15)) ``` # Installation `ggseqalign` can be installed from Bioconductor. ```{r installbioc, eval = FALSE} if (!require("BiocManager", quietly = TRUE)) install.packages("BiocManager") BiocManager::install("ggseqalign") ``` See the `r Biocpkg("BiocManager")` vignette for instructions on using multiple versions of Bioconductor. `ggseqalign` can also be installed from it's original source on GitHub (requires `devtools`) ```{r installgit, eval = FALSE} devtools::install_git("https://github.com/simeross/ggseqalign.git") ``` # Basics This package relies on two core functions, `alignment_table()` and `plot_sequence_alignment()`. At its core, the former uses `PairwiseAlignment()`, previously in `r Biocpkg("Biostrings")`, now in `r Biocpkg("pwalign")`, to align one or several query strings to a subject string to parse all information on mismatches, insertions and deletions into a table that is used as the input for plotting with `plot_sequence_alignment()`. A minimal example: ```{r minimal-example, fig.cap="Output of the minimal example code", warning=FALSE} library(ggseqalign) library(ggplot2) query_strings <- (c("boo", "fibububuzz", "bozz", "baofuzz")) subject_string <- "boofizz" alignment <- alignment_table(query_strings, subject_string) plot_sequence_alignment(alignment) + theme(text = element_text(size = 15)) ``` This package is fully compatible with `DNAStringSet`and `AAStringSet` classes from `r Biocpkg("Biostrings")`, an efficient and powerful way to handle sequence data. The two examples below use example data from the `r Biocpkg("Biostrings")` package and requires it to be installed. To install `r Biocpkg("Biostrings")`, enter ``` if (!require("BiocManager", quietly = TRUE)) install.packages("BiocManager") BiocManager::install("Biostrings") ``` This chunk demonstrates reading sequence data from a FASTA file into a `DNAStringSet`-class object and aligning it to a manually created `DNAStringSet`-class object. ```{r read-in-fasta, message= FALSE, warning=FALSE} library(ggseqalign) library(Biostrings) library(ggplot2) query_sequences <- Biostrings::readDNAStringSet(system.file("extdata", "fastaEx.fa", package = "Biostrings" )) subject_sequence <- DNAStringSet(paste0("AAACGATCGATCGTAGTCGACTGATGT", "AGTATATACGTCGTACGTAGCATCGTC", "AGTTACTGCATGCCGG")) alignment <- alignment_table(query_sequences, subject_sequence) plot_sequence_alignment(alignment) + theme(text = element_text(size = 15)) ``` # Hide mismatches The plots that `plot_sequence_alignment()` generates can become hard to read if there are too many differences, see fig. \@ref(fig:noisefig). The package allows to hide character mismatches to preserve legibility of structural differences (fig. \@ref(fig:noisefignolab)). ```{r noisefig, fig.cap="Example of a case where ggseqalign fails. If there are too many differences, the mismatches overlap each other and become noisy.", echo=TRUE, warning=FALSE} # load dna <- Biostrings::readDNAStringSet(system.file("extdata", "dm3_upstream2000.fa.gz", package = "Biostrings" )) q <- as( c(substr(dna[[1]], 100, 300)), "DNAStringSet" ) s <- as( c(substr(dna[[2]], 100, 300)), "DNAStringSet" ) names(q) <- c("noisy alignment") names(s) <- "reference" plot_sequence_alignment(alignment_table(q, s)) + theme(text = element_text(size = 15)) ``` ```{r noisefignolab, fig.cap="Hiding mismatches. Hiding character mismatches reduces visual noise if alignments have many character mismatches and preserves structural information.", echo=TRUE, warning=FALSE} plot_sequence_alignment(alignment_table(q, s), hide_mismatches = TRUE) + theme(text = element_text(size = 15)) ``` # Styling with ggplot2 Since `plot_sequence_alignment()` produces a ggplot-class object, all aspects of the plots can be modified with `r CRANpkg("ggplot2")` functions, such as `theme()`. As an example, let's recreate and modify figure \@ref(fig:showcase). ```{r ggplot-mod, fig.cap="Styling with ggplot2. In this example, text size was increased, axis labels were added, x-axis text rotated and the color scheme changed.", warning=FALSE} library(ggseqalign) library(ggplot2) library(Biostrings) dna <- readDNAStringSet(system.file("extdata", "dm3_upstream2000.fa.gz", package = "Biostrings" )) q <- dna[2:4] s <- dna[5] q[1] <- as( replaceLetterAt(q[[1]], c(5, 200, 400), "AGC"), "DNAStringSet" ) q[2] <- as( c(substr(q[[2]], 300, 1500), substr(q[[2]], 1800, 2000)), "DNAStringSet" ) q[3] <- as( replaceAt( q[[3]], 1500, paste(rep("A", 1000), collapse = "") ), "DNAStringSet" ) names(q) <- c("mismatches", "deletions", "insertion") names(s) <- "reference" pl <- plot_sequence_alignment(alignment_table(q, s)) pl <- pl + ylab("Sequence variants") + xlab("Length in bp") + scale_color_viridis_d() + theme( text = element_text(size = 20), axis.text.x = element_text(angle = 90, vjust = 0.5, hjust = 1), axis.title = element_text() ) pl ``` Some modifications may require digging into the plot object layers, this can get finicky but is possible. We can use `pl$layers` to get a summary of the object's layers. In this case, the geom_point layers that plot the dots for mismatches are entry 8 in the layer list, the white bar that indicates deletions is usually in layer 2. You may want to change the deletion bar's color if you use another plot background color. This code chunk modifies the `pl` object from the previous chunk; the above chunk has to be run prior to this one. ```{r ggplot-layer-mod, fig.cap="Modifying ggplot2 layers. In this example, deletion bars were adjusted to match background color and mismatch indicators were modified using plot layer modification", warning=FALSE} # Define background color bg <- "grey90" # Change plot background pl <- pl + theme(panel.background = element_rect( fill = bg, colour = bg )) # Match deletion to background pl$layers[[2]]$aes_params$colour <- bg # Increase mismatch indicator size and change shape pl$layers[[8]]$aes_params$size <- 2 pl$layers[[8]]$aes_params$shape <- 4 pl$layers[[8]]$aes_params$colour <- "black" pl ``` # Alignment parameters Any additional parameters to `alignment_table()` are passed on to `pwalign::pairwiseAlignment()`, check `r Biocpkg("pwalign", vignette = "PairwiseAlignments.pdf")` for a comprehensive overview over the available options. As a simple example, we may increase gap penalties for the alignment in \@ref(fig:minimal-example). ```{r minimal-example-mod, fig.cap="Modified alignment parameters.", warning=FALSE} library(ggseqalign) library(ggplot2) query_strings <- (c("boo", "fibububuzz", "bozz", "baofuzz")) subject_string <- "boofizz" alignment <- alignment_table(query_strings, subject_string, gapOpening = 20) plot_sequence_alignment(alignment) + theme(text = element_text(size = 15)) ``` # Session info The output in this vignette was produced under the following conditions: ```{r session} sessionInfo() ``` # Credit The research and data generation that was a major motivation for me to finally create this package has received funding from the Norwegian Financial Mechanism 2014-2021, [project DivGene: UMO-2019/34/H/NZ9/00559](https://eeagrants.org/archive/2014-2021/projects/PL-Basic%20Research-0012)