## ----knitr_init, echo = FALSE, cache = FALSE, results = 'hide', warning=FALSE, message=FALSE---- suppressPackageStartupMessages(library(knitr)) suppressPackageStartupMessages(library(plyr)) suppressPackageStartupMessages(library(dplyr)) suppressPackageStartupMessages(library(ggplot2)) suppressPackageStartupMessages(library(reshape2)) suppressPackageStartupMessages(library(scales)) suppressPackageStartupMessages(library(AnnotationDbi)) suppressPackageStartupMessages(library(ProteoDisco)) ## ---- label = 'Minimal Workflow', eval = TRUE, results = 'hide', message = FALSE---- # Generate the ProteoDiscography (containing the genome-sequences and annotations used throughout the incorporation of genomic variants) # In this case, we supply an existing reference genome with known annotations (GRCh37 with GENCODE annotations). ProteoDiscography.hg19 <- ProteoDisco::generateProteoDiscography( TxDb = TxDb.Hsapiens.UCSC.hg19.knownGene::TxDb.Hsapiens.UCSC.hg19.knownGene, genomeSeqs = BSgenome.Hsapiens.UCSC.hg19::BSgenome.Hsapiens.UCSC.hg19 ) # Supply the ProteoDiscography with genomic variants to incorporate in downstream analysis. This can be one or multiple VCF / MAF files. # Additional manual sequences and exon-exon mapping (i.e., splice junctions) can also be given as shown in the sections below. ProteoDiscography.hg19 <- ProteoDisco::importGenomicVariants( ProteoDiscography = ProteoDiscography.hg19, # Provide the VCF / MAF files. files = system.file('extdata', 'validationSet_hg19.vcf', package = 'ProteoDisco'), # We can replace the original samples within the VCF with nicer names. samplenames = 'Validation Set (GRCh37)', # Number of threads used for parallelization. # We run samples sequentially and parallelize within (variant-wise multi-threading). threads = 1, # To increase import-speed for this example, do not check for validity of the reference anchor with the given reference sequences. performAnchorCheck = FALSE ) # Incorporate the given genomic variants into their respective overlapping coding-sequences (i.e. transcripts). # This can be done in a sample-specific or aggregated cohort-wide manner and can be performed per exon or transcript separately. ProteoDiscography.hg19 <- ProteoDisco::incorporateGenomicVariants( ProteoDiscography = ProteoDiscography.hg19, # Do not aggregate samples and generate mutant transcripts from the mutations per sample. aggregateSamples = FALSE, # If there are multiple mutations within the same exon (CDS), place them on the same mutant CDS sequence. aggregateWithinExon = TRUE, # Aggregate multiple mutant exons (CDS) within the same transcripts instead of incorporating one at a time. aggregateWithinTranscript = TRUE, # If there are overlapping mutations on the same coding position, retain only the first of the overlapping mutations. # If set to FALSE, throw an error and specify which CDS had overlapping mutations. ignoreOverlappingMutations = TRUE, # Number of threads. threads = 1 ) ## ---- label = 'Export FASTA', eval = FALSE, results = 'hide'------------------ # # Output custom protein database (FASTA) containing the generated protein variant sequences. # ProteoDisco::exportProteoDiscography( # ProteoDiscography = ProteoDiscography.hg19, # outFile = 'example.fasta', # aggregateSamples = TRUE # ) ## ---- label = 'Logging options', eval = TRUE, results = 'hide'---------------- # Display tracing messages: ParallelLogger::clearLoggers() ParallelLogger::registerLogger(ParallelLogger::createLogger(threshold = 'TRACE', appenders =list(ParallelLogger::createConsoleAppender(layout = ParallelLogger::layoutTimestamp)))) # Or only display general information messages: ParallelLogger::clearLoggers() ParallelLogger::registerLogger(ParallelLogger::createLogger(threshold = 'INFO', appenders =list(ParallelLogger::createConsoleAppender(layout = ParallelLogger::layoutTimestamp)))) ## ---- label = 'TxDb from FASTA and GTF', eval = FALSE------------------------- # # # Download the latest annotation. # URL.annotations <- 'ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_37/gencode.v37.annotation.gff3.gz' # utils::download.file(URL.annotations, basename(URL.annotations)) # # # Download the respective reference genome (GRCh38.p12) # URL.genome <- 'ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_37/GRCh38.p12.genome.fa.gz' # utils::download.file(URL.genome, basename(URL.genome)) # # # Use the latest annotations to generate a TxDb. # TxDb <- GenomicFeatures::makeTxDbFromGFF( # file = basename(URL.annotations), # dataSource = 'GENCODE (v37)', # organism = 'Homo sapiens', taxonomyId = 9606 # ) # # # Import the genome-sequences. # genomeSeqs <- Biostrings::readDNAStringSet(filepath = basename(URL.genome), format = 'fasta') # # # Clean the chromosomal names and use the chr-prefix. # names(genomeSeqs) <- gsub(' .*', '', names(genomeSeqs)) # # # Generate the ProteoDiscography. # ProteoDiscography <- ProteoDisco::generateProteoDiscography( # TxDb = TxDb, # genomeSeqs = genomeSeqs, # geneticCode = 'Standard' # ) ## ---- label = 'Generate ProteoDiscrography from GRCh37 resources', eval = TRUE, results = 'hide'---- # Attach the required packages. require(BSgenome.Hsapiens.UCSC.hg19) require(TxDb.Hsapiens.UCSC.hg19.knownGene) # Generate the ProteoDiscography. ProteoDiscography.hg19 <- ProteoDisco::generateProteoDiscography( TxDb = TxDb.Hsapiens.UCSC.hg19.knownGene::TxDb.Hsapiens.UCSC.hg19.knownGene, genomeSeqs = BSgenome.Hsapiens.UCSC.hg19::BSgenome.Hsapiens.UCSC.hg19 ) ## ---- label = 'Inspection', eval = TRUE, results = 'hide'--------------------- print(ProteoDiscography.hg19) summary(ProteoDiscography.hg19) ## ---- label = 'Generate ProteoDiscrography (GRCh37) for subsequent testing', eval = TRUE, results = 'hide'---- # Lets produce a ProteoDiscography using pre-generated (BioConductor) resources for hg19 with UCSC annotations. require(BSgenome.Hsapiens.UCSC.hg19) require(TxDb.Hsapiens.UCSC.hg19.knownGene) # Initialize the ProteoDiscography. ProteoDiscography.hg19 <- ProteoDisco::generateProteoDiscography( TxDb = TxDb.Hsapiens.UCSC.hg19.knownGene::TxDb.Hsapiens.UCSC.hg19.knownGene, genomeSeqs = BSgenome.Hsapiens.UCSC.hg19::BSgenome.Hsapiens.UCSC.hg19 ) # Select one or more VCF or MAF files. # In this case, we make use of the provided GRCh37 test file. files.muts <- c( system.file('extdata', 'validationSet_hg19.vcf', package = 'ProteoDisco') ) # Import the genomic (somatic) variants. ProteoDiscography.hg19 <- ProteoDisco::importGenomicVariants( ProteoDiscography = ProteoDiscography.hg19, # Provide the VCF / MAF files. files = files.muts, # We can replace the original samples within the VCF with nicer names. samplenames = 'Validation Set (GRCh37)', # For illustration purposes, do not check the validity of the reference anchor. performAnchorCheck = FALSE ) ## ---- label = 'Inspect example ProteoDiscrography (GRCh37)', eval = TRUE, results = 'hide'---- library(ggplot2) # Print an overview of supplied variants, their respective mutational types and an overview per patients. summary(ProteoDiscography.hg19, verbose = FALSE) # We can also capture the summary output and display / handle only certain parts. # The 'verbose' parameters toggles whether additional information is printed to the console. z <- summary(ProteoDiscography.hg19, verbose = FALSE) # Generate a quick overview of the mutational categories (SNV, MNV and InDels) per imported sample. reshape2::melt(z$overviewMutations, id.vars = 'sample') %>% dplyr::filter(!is.na(value)) %>% ggplot2::ggplot(ggplot2::aes(x = sample, y = value, fill = variable)) + ggplot2::geom_bar(stat = 'identity', width = .8, color = 'black', position = ggplot2::position_dodge(preserve = 'single')) + ggplot2::scale_y_continuous(trans = scales::pseudo_log_trans(), breaks = c(0, 10, 100, 1000, 10000)) + ggplot2::labs(x = 'Provided samples', y = 'Nr. of variants (log10)') + ggplot2::scale_fill_brewer(name = 'Category', palette = 'Greens') + ggplot2::theme_minimal() ## ---- label = 'Add manual transcript sequences', eval = TRUE, results = 'hide', cache = TRUE---- # TMPRSS2-ERG sequence from ENA. testSeq1 <- Biostrings::DNAString('ATGACCGCGTCCTCCTCCAGCGACTATGGACAGACTTCCAAGATGAGCCCACGCGTCCCTCAGCAGGATTGGCTGTCTCAACCCCCAGCCAGGGTCACCATCAAAATGGAATGTAACCCTAGCCAGGTGAATGGCTCAAGGAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCAGCCCAGACACCGTTGGGATGAACTACGGCAGCTACATGGAGGAGAAGCACATGCCACCCCCAAACATGACCACGAACGAGCGCAGAGTTATCGTGCCAGCAGATCCTACGCTATGGAGTACAGACCATGTGCGGCAGTGGCTGGAGTGGGCGGTGAAAGAATATGGCCTTCCAGACGTCAACATCTTGTTATTCCAGAACATCGATGGGAAGGAACTGTGCAAGATGACCAAGGACGACTTCCAGAGGCTCACCCCCAGCTACAACGCCGACATCCTTCTCTCACATCTCCACTACCTCAGAGAGACTCCTCTTCCACATTTGACTTCAGATGATGTTGATAAAGCCTTACAAAACTCTCCACGGTTAATGCATGCTAGAAACACAGGGGGTGCAGCTTTTATTTTCCCAAATACTTCAGTATATCCTGAAGCTACGCAAAGAATTACAACTAGGCCAGTCTCTTACAGATAA') # Partial CDS of BCR-ABL from ENA. testSeq2 <- Biostrings::DNAString('ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAAAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAGGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAATGGGGAATGGTTTGAAGCCCAAACCAAAAATGGCCAAGGCTGGGTCCCAAGCAACTACATCACGCCAGTCAACAGTCTGGAGAAACACTCCTGGTACCATGGGCCTGTGTCCCGCAATGCCGCTGAGTATCTGCTGAGCAGCGGGATCAAT') # Generate DataFrame containing the mutant sequences and metadata and add these to our test sample. manualSeq <- S4Vectors::DataFrame( sample = rep('Validation Set (GRCh37)', 2), identifier = c('TMPRSS2-ERG prostate cancer specific isoform 1', 'Homo sapiens (human) partial bcr/c-abl oncogene protein'), gene = c('TMPRSS2-ERG', 'BCR-ABL1'), Tx.SequenceMut = Biostrings::DNAStringSet(base::list(testSeq1, testSeq2)) ) # Add to ProteoDiscography. ProteoDiscography.hg19 <- ProteoDisco::importTranscriptSequences( ProteoDiscography.hg19, transcripts = manualSeq, removeExisting = TRUE ) ## ---- label = 'View imported ProteoDiscography records', eval = TRUE, results = 'hide'---- # Retrieve / view the records imported into the ProteoDiscography. getDiscography(ProteoDiscography.hg19) ## ---- label = 'Incorporate genomic variants into ProteoDiscrography (GRCh37)', eval = TRUE, results = 'hide', message = FALSE---- ProteoDiscography.hg19 <- ProteoDisco::incorporateGenomicVariants( ProteoDiscography = ProteoDiscography.hg19, # Do not aggregate samples and generate mutant transcripts from the mutations per sample. aggregateSamples = FALSE, # If there are multiple mutations within the same exon (CDS), place them on the same mutant CDS sequence. aggregateWithinExon = TRUE, # Aggregate multiple mutant exons (CDS) within the same transcripts instead of incorporating one at a time. aggregateWithinTranscript = TRUE, # If there are overlapping mutations on the same coding position, retain only the first of the overlapping mutations. # If set to FALSE, throw an error and specify which CDS had overlapping mutations. ignoreOverlappingMutations = TRUE, # Number of threads. threads = 4 ) ## ---- label = 'Inspection post-incorporation', eval = TRUE, results = 'hide'---- # Simply print the ProteoDiscography and it will state the number of mutant transcripts currently generated. summary(ProteoDiscography.hg19) # Retrieve the mutant transcript sequences. # This will retrieve a list of all the generated (and imported) transcript sequences per input type and the respective amino-acid sequence. x <- ProteoDisco::mutantTranscripts(ProteoDiscography.hg19) # Visualization of the number of incorporated genomic mutations per transcript. barplot(table(x$genomicVariants$numberOfMutationsInTx)) ## ---- label = 'Subsetting', eval = TRUE, results = 'hide'--------------------- x <- ProteoDisco::mutantTranscripts(ProteoDiscography.hg19) x <- x$genomicVariants x # Only keep the first 10 mutant transcripts of the incorporated genomic variants. ProteoDiscography.hg19.subset <- ProteoDisco::setMutantTranscripts(ProteoDiscography.hg19, x[1:10,], slotType = 'genomicVariants') y <- ProteoDisco::mutantTranscripts(ProteoDiscography.hg19.subset) y <- y$genomicVariants y ## ---- label = 'Import splice-junctions', eval = TRUE, results = 'hide', message = FALSE---- # Import splice-junctions from BED files. files.Splicing <- c( system.file('extdata', 'spliceJunctions_pyQUILTS_chr22.bed', package = 'ProteoDisco') ) # Import splice-junctions from BED or SJ,out.tab files into our ProteoDiscography. ProteoDiscography.hg19 <- ProteoDisco::importSpliceJunctions( ProteoDiscography = ProteoDiscography.hg19, inputSpliceJunctions = system.file('extdata', 'spliceJunctions_pyQUILTS_chr22.bed', package = 'ProteoDisco'), # (Optional) Rename samples. samples = c('pyQUILTS'), # Specify that the given BED files are obtained from TopHat. # Chromosomal coordinates from TopHat require additional formatting. isTopHat = TRUE, aggregateSamples = FALSE, removeExisting = TRUE ) # Or, import splice-junctions (even spanning different chromosomes) based on our format. testSJ <- readr::read_tsv(system.file('extdata', 'validationSetSJ_hg19.txt', package = 'ProteoDisco')) %>% dplyr::select(sample, identifier, junctionA, junctionB) # Add custom SJ to ProteoDiscography. ProteoDiscography.hg19 <- ProteoDisco::importSpliceJunctions( ProteoDiscography = ProteoDiscography.hg19, inputSpliceJunctions = testSJ, # Remove existing SJ-input. removeExisting = TRUE ) # Generate junction-models from non-canonical splice-junctions. ProteoDiscography.hg19 <- ProteoDisco::generateJunctionModels( ProteoDiscography = ProteoDiscography.hg19, # Max. distance from a known exon-boundary before introducing a novel exon. # If an adjacent exon is found within this distance, it will shorten or elongate that exon towards the SJ. maxDistance = 150, # Should we skip known exon-exon junctions (in which both the acceptor and donor are located on known adjacent exons within the same transcript) skipCanonical = TRUE, # Perform on multiple threads (optional) threads = 4 ) ## ---- label = 'Check proteotypic fragments.', eval = FALSE, results = 'hide'---- # # Load additional peptide sequences against which proteotypic fragments are checked. # # In this case, load the first 100 human Swiss-Prot/Uniprot database entries. # peptides.SwissProt <- base::textConnection(RCurl::getURL('https://www.uniprot.org/uniprot/?query=*&format=fasta&limit=100&fil=organism:%22Homo%20sapiens%20(Human)%20[9606]%22%20AND%20reviewed:yes')) %>% # seqinr::read.fasta(., seqtype = 'AA', seqonly = FALSE, as.string = TRUE) %>% # Biostrings::AAStringSetList() %>% # unlist() # # # Check proteotypic fragments. # ProteoDiscography.hg19 <- ProteoDisco::checkProteotypicFragments( # ProteoDiscography.hg19, # additionalPeptides = peptides.SwissProt, # # Protease used in the experiment (see cleaver package) # enzymUsed = 'trypsin', # # Number of potentially-missed cleavages (see cleaver package) # missedCleavages = 1, # # Should proteotypic fragments also be unique among the generated variant-sequences. # checkWithinMutantSeqs = FALSE # ) # # # We can now appreciate that additional information is added to the mutant transcript denoting how many, and which fragments are unique to the mutant transcripts. # ProteoDisco::mutantTranscripts(ProteoDiscography.hg19) # ## ---- label = 'Converting gene symbols', eval = TRUE, results = 'hide'-------- require(org.Hs.eg.db) # Retrieve the all imported mutant transcripts. x <- ProteoDisco::mutantTranscripts(ProteoDiscography.hg19) # Convert ENTREZ identifiers to gene symbols. geneSymbols <- unique(AnnotationDbi::select( org.Hs.eg.db, keys = x$genomicVariants$geneID, keytype = 'ENTREZID', columns = 'SYMBOL') ) # Add the gene symbols back to the mutant transcript. x$genomicVariants <- merge( x$genomicVariants, geneSymbols, by.x = 'geneID', by.y = 'ENTREZID', all.x = TRUE ) # Add the mutant transcripts (with symbols) back into the ProteoDiscography. ProteoDiscography.hg19 <- ProteoDisco::setMutantTranscripts( ProteoDiscography.hg19, transcripts = x$genomicVariants, slotType = 'genomicVariants' ) # We now have the SYMBOL column in our mutant transcripts DataFrame. head(ProteoDisco::mutantTranscripts(ProteoDiscography.hg19)$genomicVariants) ## ---- label = 'Export mutant proteins to FASTA', eval = TRUE, results = 'hide'---- ProteoDisco::exportProteoDiscography( ProteoDiscography = ProteoDiscography.hg19, outFile = 'example.fasta', aggregateSamples = TRUE ) ## ---- label = 'Session Information', eval = TRUE------------------------------ utils::sessionInfo()