chromosome	final_positions	variant_type	ref_allele	alt_allele	final_variations	conservation	gene_name	in_exon	Entry	Status	Protein.names	Gene.names	Annotation	Tissue.specificity	Gene.ontology..biological.process.	Involvement.in.disease	Cross.reference..Orphanet.	PubMed.ID
1	664834	nonsynonymous	T	G	1	0.4	LOC100133331	TRUE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
1	1026310	nonsynonymous	G	C	0.6	0	C1orf159	FALSE	Q96HA4	reviewed	Uncharacterized protein C1orf159	C1orf159 UNQ2998/PRO9739	3 out of 5	NA	NA	NA	NA	12975309; 14702039; 16710414; 15489334
1	1636330	nonsynonymous	G	A	0.45	0	CDK11B	FALSE	P21127	reviewed	Cyclin-dependent kinase 11B (EC 2.7.11.22) (Cell division cycle 2-like protein kinase 1) (CLK-1) (Cell division protein kinase 11B) (Galactosyltransferase-associated protein kinase p58/GTA) (PITSLRE serine/threonine-protein kinase CDC2L1) (p58 CLK-1)	CDK11B CDC2L1 CDK11 PITSLREA PK58	5 out of 5	TISSUE SPECIFICITY: Expressed ubiquitously. Some evidence of isoform-specific tissue distribution. {ECO:0000269|PubMed:8195233, ECO:0000269|PubMed:9750192}.	apoptotic process [GO:0006915]; cell proliferation [GO:0008283]; mitotic nuclear division [GO:0007067]; protein phosphorylation [GO:0006468]; regulation of cell growth [GO:0001558]; regulation of mRNA processing [GO:0050684]; regulation of transcription, DNA-templated [GO:0006355]	NA	NA	2217177; 2006197; 1639388; 8195233; 9750192; 9580558; 10882096; 14511641; 12501247; 12624090; 15883043; 17081983; 16964243; 16327805; 18216018; 18220336; 18669648; 19690332; 20068231; 21406692; 23186163; 24275569; 17344846
1	1636330	nonsynonymous	G	A	0.45	0	CDK11A	FALSE	Q9UQ88	reviewed	Cyclin-dependent kinase 11A (EC 2.7.11.22) (Cell division cycle 2-like protein kinase 2) (Cell division protein kinase 11A) (Galactosyltransferase-associated protein kinase p58/GTA) (PITSLRE serine/threonine-protein kinase CDC2L2)	CDK11A CDC2L2 CDC2L3 PITSLREB	5 out of 5	TISSUE SPECIFICITY: Expressed ubiquitously. Some evidence of isoform-specific tissue distribution. {ECO:0000269|PubMed:8195233, ECO:0000269|PubMed:9750192}.	apoptotic process [GO:0006915]; mitotic nuclear division [GO:0007067]; protein phosphorylation [GO:0006468]; regulation of cell growth [GO:0001558]; regulation of mRNA processing [GO:0050684]; regulation of transcription, DNA-templated [GO:0006355]	NA	NA	8195233; 9750192; 16710414; 15489334; 12501247; 10882096; 12624090
1	2433894	nonsynonymous	G	A	0.6875	0	PLCH2	TRUE	O75038	reviewed	1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase eta-2 (EC 3.1.4.11) (Phosphoinositide phospholipase C-eta-2) (Phosphoinositide phospholipase C-like 4) (PLC-L4) (Phospholipase C-like protein 4) (Phospholipase C-eta-2) (PLC-eta2)	PLCH2 KIAA0450 PLCL4	5 out of 5	TISSUE SPECIFICITY: Expressed in retina and kidney. {ECO:0000269|PubMed:16107206}.	inositol phosphate metabolic process [GO:0043647]; intracellular signal transduction [GO:0035556]; lipid catabolic process [GO:0016042]; phosphatidylinositol metabolic process [GO:0046488]	NA	NA	16107206; 9455484; 16710414; 15489334
1	3329213	nonsynonymous	G	A	0.388888888888889	1	PRDM16	TRUE	Q9HAZ2	reviewed	PR domain zinc finger protein 16 (PR domain-containing protein 16) (Transcription factor MEL1) (MDS1/EVI1-like gene 1)	PRDM16 KIAA1675 MEL1 PFM13	5 out of 5	TISSUE SPECIFICITY: Expressed in uterus and kidney. Expressed in both cardiomyocytes and interstitial cells. {ECO:0000269|PubMed:11050005, ECO:0000269|PubMed:12816872, ECO:0000269|PubMed:23768516}.	brown fat cell differentiation [GO:0050873]; negative regulation of granulocyte differentiation [GO:0030853]; negative regulation of transcription, DNA-templated [GO:0045892]; negative regulation of transcription from RNA polymerase II promoter [GO:0000122]; negative regulation of transforming growth factor beta receptor signaling pathway [GO:0030512]; neurogenesis [GO:0022008]; palate development [GO:0060021]; positive regulation of brown fat cell differentiation [GO:0090336]; positive regulation of transcription, DNA-templated [GO:0045893]; regulation of cellular respiration [GO:0043457]; somatic stem cell population maintenance [GO:0035019]; tongue development [GO:0043586]; transcription, DNA-templated [GO:0006351]; white fat cell differentiation [GO:0050872]	DISEASE: Left ventricular non-compaction 8 (LVNC8) [MIM:615373]: A disease due to an arrest of myocardial morphogenesis. It is characterized by a hypertrophic left ventricle with deep trabeculations and with poor systolic function, with or without associated left ventricular dilation. In some cases, it is associated with other congenital heart anomalies. {ECO:0000269|PubMed:23768516}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Cardiomyopathy, dilated 1LL (CMD1LL) [MIM:615373]: A disorder characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death. {ECO:0000269|PubMed:23768516}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Note=A chromosomal aberration involving PRDM16 is found in myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Reciprocal translocation t(1;3)(p36;q21). Isoform 4 is specifically expressed in adult T-cell leukemia. {ECO:0000269|PubMed:11050005, ECO:0000269|PubMed:12557231}.	1606;154;54260;	11050005; 11214970; 12168954; 16710414; 15489334; 12816872; 12557231; 14656887; 19049980; 25578880; 23768516
1	6111721	nonsynonymous	C	T	0.444444444444444	0.7	KCNAB2	FALSE	Q13303	reviewed	Voltage-gated potassium channel subunit beta-2 (EC 1.1.1.-) (K(+) channel subunit beta-2) (Kv-beta-2) (hKvbeta2)	KCNAB2 KCNA2B KCNK2	5 out of 5	TISSUE SPECIFICITY: Detected in myelinated nerve fibers in the spinal cord, in the juxtaparanodal region of the nodes of Ranvier, but also in the paranodal region (PubMed:11086297). Detected in hippocampus (at protein level) (PubMed:21357749). Detected in hippocampus (PubMed:7649300). {ECO:0000269|PubMed:11086297, ECO:0000269|PubMed:21357749, ECO:0000269|PubMed:7649300}.	hematopoietic progenitor cell differentiation [GO:0002244]; NADPH oxidation [GO:0070995]; neuromuscular process [GO:0050905]; oxidation-reduction process [GO:0055114]; regulation of potassium ion transmembrane transport [GO:1901379]; regulation of protein localization to cell surface [GO:2000008]	NA	1606;	7649300; 14702039; 16710414; 15489334; 11086297; 11825900; 19690332; 19608861; 21269460; 21357749; 22814378; 23186163; 25944712; 
1	12907518	nonsynonymous	TC	AA	0.433333333333333	1	HNRNPCL4	TRUE	P0DMR1	reviewed	Heterogeneous nuclear ribonucleoprotein C-like 4	HNRNPCL4	2 out of 5	NA	NA	NA	NA	16710414
1	12907518	nonsynonymous	TC	AA	0.433333333333333	1	HNRNPCL3	TRUE	B7ZW38	reviewed	Heterogeneous nuclear ribonucleoprotein C-like 3	HNRNPCL3	2 out of 5	NA	NA	NA	NA	16710414; 15489334
1	12907518	nonsynonymous	TC	AA	0.433333333333333	1	HNRNPCL1	TRUE	O60812	reviewed	Heterogeneous nuclear ribonucleoprotein C-like 1 (hnRNP C-like-1) (hnRNP core protein C-like 1)	HNRNPCL1 HNRPCL1	3 out of 5	NA	NA	NA	NA	16710414; 15489334
1	12919642	nonsynonymous	G	A	0.310344827586207	0	PRAMEF2	TRUE	O60811	reviewed	PRAME family member 2	PRAMEF2	4 out of 5	NA	negative regulation of apoptotic process [GO:0043066]; negative regulation of cell differentiation [GO:0045596]; negative regulation of retinoic acid receptor signaling pathway [GO:0048387]; negative regulation of transcription, DNA-templated [GO:0045892]; positive regulation of cell proliferation [GO:0008284]	NA	NA	16710414; 15489334
1	12919682	nonsynonymous	C	T	0.333333333333333	0	PRAMEF2	TRUE	O60811	reviewed	PRAME family member 2	PRAMEF2	4 out of 5	NA	negative regulation of apoptotic process [GO:0043066]; negative regulation of cell differentiation [GO:0045596]; negative regulation of retinoic acid receptor signaling pathway [GO:0048387]; negative regulation of transcription, DNA-templated [GO:0045892]; positive regulation of cell proliferation [GO:0008284]	NA	NA	16710414; 15489334
1	15655944	nonsynonymous	G	A	0.55	0	FHAD1	TRUE	B1AJZ9	reviewed	Forkhead-associated domain-containing protein 1 (FHA domain-containing protein 1)	FHAD1 KIAA1937	2 out of 5	NA	NA	NA	NA	16710414; 14702039
1	22927241	nonsynonymous	G	A	0.416666666666667	1	EPHA8	TRUE	P29322	reviewed	Ephrin type-A receptor 8 (EC 2.7.10.1) (EPH- and ELK-related kinase) (EPH-like kinase 3) (EK3) (hEK3) (Tyrosine-protein kinase receptor EEK)	EPHA8 EEK HEK3 KIAA1459	5 out of 5	NA	axon guidance [GO:0007411]; cell adhesion [GO:0007155]; ephrin receptor signaling pathway [GO:0048013]; neuron projection development [GO:0031175]; neuron remodeling [GO:0016322]; positive regulation of MAPK cascade [GO:0043410]; positive regulation of phosphatidylinositol 3-kinase activity [GO:0043552]; protein autophosphorylation [GO:0046777]; regulation of cell adhesion [GO:0030155]; regulation of cell adhesion mediated by integrin [GO:0033628]; substrate-dependent cell migration [GO:0006929]	NA	NA	16710414; 15489334; 10819331; 1648701; 9267020; 10498895; 11416136; 17875921; 20496116; 17344846
1	23110948	nonsynonymous	G	A	0.416666666666667	1	EPHB2	TRUE	P29323	reviewed	Ephrin type-B receptor 2 (EC 2.7.10.1) (Developmentally-regulated Eph-related tyrosine kinase) (ELK-related tyrosine kinase) (EPH tyrosine kinase 3) (EPH-like kinase 5) (EK5) (hEK5) (Renal carcinoma antigen NY-REN-47) (Tyrosine-protein kinase TYRO5) (Tyrosine-protein kinase receptor EPH-3)	EPHB2 DRT EPHT3 EPTH3 ERK HEK5 TYRO5	5 out of 5	TISSUE SPECIFICITY: Brain, heart, lung, kidney, placenta, pancreas, liver and skeletal muscle. Preferentially expressed in fetal brain.	angiogenesis [GO:0001525]; axonal fasciculation [GO:0007413]; axon guidance [GO:0007411]; camera-type eye morphogenesis [GO:0048593]; central nervous system projection neuron axonogenesis [GO:0021952]; commissural neuron axon guidance [GO:0071679]; corpus callosum development [GO:0022038]; dendritic spine development [GO:0060996]; dendritic spine morphogenesis [GO:0060997]; ephrin receptor signaling pathway [GO:0048013]; inner ear morphogenesis [GO:0042472]; learning [GO:0007612]; negative regulation of axonogenesis [GO:0050771]; nervous system development [GO:0007399]; optic nerve morphogenesis [GO:0021631]; palate development [GO:0060021]; peptidyl-tyrosine phosphorylation [GO:0018108]; phosphorylation [GO:0016310]; positive regulation of long-term neuronal synaptic plasticity [GO:0048170]; positive regulation of synapse assembly [GO:0051965]; regulation of body fluid levels [GO:0050878]; retinal ganglion cell axon guidance [GO:0031290]; urogenital system development [GO:0001655]	DISEASE: Prostate cancer (PC) [MIM:176807]: A malignancy originating in tissues of the prostate. Most prostate cancers are adenocarcinomas that develop in the acini of the prostatic ducts. Other rare histopathologic types of prostate cancer that occur in approximately 5% of patients include small cell carcinoma, mucinous carcinoma, prostatic ductal carcinoma, transitional cell carcinoma, squamous cell carcinoma, basal cell carcinoma, adenoid cystic carcinoma (basaloid), signet-ring cell carcinoma and neuroendocrine carcinoma. {ECO:0000269|PubMed:15300251, ECO:0000269|PubMed:16155194}. Note=The gene represented in this entry may be involved in disease pathogenesis. EPHB2 mutations have been found in a prostate cancer cell line derived from a brain metastasis.	1331;	8033077; 8589679; 9696046; 16710414; 7898931; 7601466; 7688222; 1648701; 9267020; 10508479; 18691976; 19369195; 9933164; 17897949; 15300251; 16155194; 17344846
1	27676026	nonsynonymous	G	A	0.5	1	SYTL1	FALSE	Q8IYJ3	reviewed	Synaptotagmin-like protein 1 (Exophilin-7) (Protein JFC1)	SYTL1 SLP1 SB146	5 out of 5	TISSUE SPECIFICITY: Highly expressed in bone marrow and lymphoid tissues. Detected at lower levels in cerebellum, occipital lobe, prostate, stomach, kidney, appendix, lung and trachea. Expressed in cytotoxic T-lymphocytes (CTL). {ECO:0000269|PubMed:11278853, ECO:0000269|PubMed:18266782}.	calcium ion-regulated exocytosis of neurotransmitter [GO:0048791]; exocytosis [GO:0006887]; intracellular protein transport [GO:0006886]; regulation of calcium ion-dependent exocytosis [GO:0017158]; vesicle fusion [GO:0006906]	NA	NA	14702039; 16710414; 15489334; 11278853; 18266782; 19690332; 23186163
1	53370357	nonsense	G	T	0.607142857142857	1	ECHDC2	TRUE	Q86YB7	reviewed	Enoyl-CoA hydratase domain-containing protein 2, mitochondrial	ECHDC2	2 out of 5	NA	fatty acid metabolic process [GO:0006631]	NA	NA	14702039; 15489334; 24275569
1	67147696	nonsynonymous	C	T	0.523809523809524	1	SGIP1	FALSE	Q9BQI5	reviewed	SH3-containing GRB2-like protein 3-interacting protein 1 (Endophilin-3-interacting protein)	SGIP1	5 out of 5	TISSUE SPECIFICITY: Specifically expressed in brain. {ECO:0000269|PubMed:15919751}.	endocytosis [GO:0006897]; membrane tubulation [GO:0097320]; positive regulation of energy homeostasis [GO:2000507]; positive regulation of feeding behavior [GO:2000253]; positive regulation of receptor-mediated endocytosis [GO:0048260]; response to dietary excess [GO:0002021]	NA	NA	11230166; 17974005; 16710414; 15489334; 15919751; 20946875; 21407171
1	74671074	nonsynonymous	C	T	0.457142857142857	1	FPGT-TNNI3K	FALSE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
1	74671074	nonsynonymous	C	T	0.457142857142857	1	FPGT	TRUE	O14772	reviewed	Fucose-1-phosphate guanylyltransferase (EC 2.7.7.30) (GDP-L-fucose diphosphorylase) (GDP-L-fucose pyrophosphorylase)	FPGT GFPP	5 out of 5	TISSUE SPECIFICITY: Expressed in many tissues.	fucose metabolic process [GO:0006004]	NA	NA	9804772; 14702039; 16710414; 15489334
1	94467142	nonsynonymous	TC	CT	0.428571428571429	0	ABCA4	FALSE	P78363	reviewed	Retinal-specific ATP-binding cassette transporter (ATP-binding cassette sub-family A member 4) (RIM ABC transporter) (RIM protein) (RmP) (Stargardt disease protein)	ABCA4 ABCR	5 out of 5	TISSUE SPECIFICITY: Retinal-specific. Seems to be exclusively found in the rims of rod photoreceptor cells.	lipid transport [GO:0006869]; phospholipid transfer to membrane [GO:0006649]; photoreceptor cell maintenance [GO:0045494]; phototransduction, visible light [GO:0007603]; retinoid metabolic process [GO:0001523]; transmembrane transport [GO:0055085]; transport [GO:0006810]; visual perception [GO:0007601]	DISEASE: Stargardt disease 1 (STGD1) [MIM:248200]: A common hereditary macular degeneration. It is characterized by decreased central vision, atrophy of the macula and underlying retinal pigment epithelium, and frequent presence of prominent flecks in the posterior pole of the retina. {ECO:0000269|PubMed:10090887, ECO:0000269|PubMed:10206579, ECO:0000269|PubMed:10612508, ECO:0000269|PubMed:10634594, ECO:0000269|PubMed:10711710, ECO:0000269|PubMed:10746567, ECO:0000269|PubMed:10958763, ECO:0000269|PubMed:11328725, ECO:0000269|PubMed:11385708, ECO:0000269|PubMed:11527935, ECO:0000269|PubMed:11594993, ECO:0000269|PubMed:18977788, ECO:0000269|PubMed:24444108, ECO:0000269|PubMed:9054934, ECO:0000269|PubMed:9490294, ECO:0000269|PubMed:9503029, ECO:0000269|PubMed:9781034, ECO:0000269|PubMed:9973280}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Fundus flavimaculatus (FFM) [MIM:248200]: Autosomal recessive retinal disorder very similar to Stargardt disease. In contrast to Stargardt disease, FFM is characterized by later onset and slowly progressive course. {ECO:0000269|PubMed:11379881, ECO:0000269|PubMed:11385708, ECO:0000269|PubMed:9781034}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Macular degeneration, age-related, 2 (ARMD2) [MIM:153800]: A form of age-related macular degeneration, a multifactorial eye disease and the most common cause of irreversible vision loss in the developed world. In most patients, the disease is manifest as ophthalmoscopically visible yellowish accumulations of protein and lipid that lie beneath the retinal pigment epithelium and within an elastin-containing structure known as Bruch membrane. {ECO:0000269|PubMed:19028736, ECO:0000269|PubMed:9295268}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.; DISEASE: Cone-rod dystrophy 3 (CORD3) [MIM:604116]: An inherited retinal dystrophy characterized by retinal pigment deposits visible on fundus examination, predominantly in the macular region, and initial loss of cone photoreceptors followed by rod degeneration. This leads to decreased visual acuity and sensitivity in the central visual field, followed by loss of peripheral vision. Severe loss of vision occurs earlier than in retinitis pigmentosa. {ECO:0000269|PubMed:10958761, ECO:0000269|PubMed:11385708, ECO:0000269|PubMed:11527935}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Retinitis pigmentosa 19 (RP19) [MIM:601718]: A retinal dystrophy belonging to the group of pigmentary retinopathies. Retinitis pigmentosa is characterized by retinal pigment deposits visible on fundus examination and primary loss of rod photoreceptor cells followed by secondary loss of cone photoreceptors. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. RP19 is characterized by choroidal atrophy. Note=The disease is caused by mutations affecting the gene represented in this entry.	279;1872;791;827;	9054934; 9202155; 9503029; 9490294; 16710414; 17286855; 10075733; 9466990; 11320094; 9295268; 9781034; 9973280; 10090887; 10612508; 10206579; 10880298; 10958763; 10958761; 10746567; 10634594; 10711710; 11017087; 11594993; 11384574; 11346402; 11379881; 11385708; 11328725; 11527935; 12111378; 16959974; 19028736; 18977788; 24444108
1	150551327	nonsynonymous	G	A	0.428571428571429	1	MCL1	TRUE	Q07820	reviewed	Induced myeloid leukemia cell differentiation protein Mcl-1 (Bcl-2-like protein 3) (Bcl2-L-3) (Bcl-2-related protein EAT/mcl1) (mcl1/EAT)	MCL1 BCL2L3	5 out of 5	NA	apoptotic mitochondrial changes [GO:0008637]; cell fate determination [GO:0001709]; cellular homeostasis [GO:0019725]; extrinsic apoptotic signaling pathway in absence of ligand [GO:0097192]; intrinsic apoptotic signaling pathway in response to DNA damage [GO:0008630]; multicellular organism development [GO:0007275]; negative regulation of anoikis [GO:2000811]; negative regulation of extrinsic apoptotic signaling pathway in absence of ligand [GO:2001240]; negative regulation of intrinsic apoptotic signaling pathway [GO:2001243]; positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway [GO:1903378]; regulation of response to DNA damage stimulus [GO:2001020]; response to cytokine [GO:0034097]	NA	NA	7682708; 8790944; 11130466; 10766760; 10837489; 14702039; 16710414; 15489334; 10634649; 15122313; 9671497; 12149273; 12223490; 15077116; 15241487; 15989957; 16543145; 18669648; 23024798; 23055042; 17389404; 20562877; 18987736
1	151105076	nonsynonymous	G	A	0.615384615384615	1	SEMA6C	TRUE	Q9H3T2	reviewed	Semaphorin-6C (Semaphorin-Y) (Sema Y)	SEMA6C KIAA1869 SEMAY	5 out of 5	TISSUE SPECIFICITY: In adult tissues, expressed only in skeletal muscle. {ECO:0000269|PubMed:12110693}.	axon guidance [GO:0007411]; negative regulation of axon extension involved in axon guidance [GO:0048843]; neural crest cell migration [GO:0001755]; positive regulation of cell migration [GO:0030335]; semaphorin-plexin signaling pathway [GO:0071526]	NA	NA	12110693; 11347906; 16710414; 
1	155721911	nonsynonymous	C	T	0.421052631578947	1	GON4L	TRUE	Q3T8J9	reviewed	GON-4-like protein (GON-4 homolog)	GON4L GON4 KIAA1606	5 out of 5	NA	B cell differentiation [GO:0030183]; negative regulation of transcription, DNA-templated [GO:0045892]; transcription, DNA-templated [GO:0006351]	NA	NA	11230166; 16710414; 15489334; 10997877; 17370265; 19413330; 21406692; 23186163
1	161976172	nonsynonymous	T	C	0.470588235294118	1	OLFML2B	TRUE	Q68BL8	reviewed	Olfactomedin-like protein 2B (Photomedin-2)	OLFML2B	3 out of 5	NA	NA	NA	NA	14702039; 17974005; 16710414; 15489334
1	169586281	nonsynonymous	C	T	0.478260869565217	1	SELP	TRUE	P16109	reviewed	P-selectin (CD62 antigen-like family member P) (Granule membrane protein 140) (GMP-140) (Leukocyte-endothelial cell adhesion molecule 3) (LECAM3) (Platelet activation dependent granule-external membrane protein) (PADGEM) (CD antigen CD62P)	SELP GMRP GRMP	5 out of 5	TISSUE SPECIFICITY: Stored in the alpha-granules of platelets and Weibel-Palade bodies of endothelial cells. Upon cell activation by agonists, P-selectin is transported rapidly to the cell surface.	calcium-mediated signaling using intracellular calcium source [GO:0035584]; cell adhesion [GO:0007155]; defense response to Gram-negative bacterium [GO:0050829]; heterophilic cell-cell adhesion via plasma membrane cell adhesion molecules [GO:0007157]; inflammatory response [GO:0006954]; leukocyte cell-cell adhesion [GO:0007159]; leukocyte migration [GO:0050900]; leukocyte tethering or rolling [GO:0050901]; platelet degranulation [GO:0002576]; positive regulation of cell adhesion [GO:0045785]; positive regulation of leukocyte migration [GO:0002687]; positive regulation of phosphatidylinositol 3-kinase signaling [GO:0014068]; positive regulation of platelet activation [GO:0010572]; regulation of cellular extravasation [GO:0002691]; regulation of integrin activation [GO:0033623]; response to lipopolysaccharide [GO:0032496]; response to organic cyclic compound [GO:0014070]	DISEASE: Ischemic stroke (ISCHSTR) [MIM:601367]: A stroke is an acute neurologic event leading to death of neural tissue of the brain and resulting in loss of motor, sensory and/or cognitive function. Ischemic strokes, resulting from vascular occlusion, is considered to be a highly complex disease consisting of a group of heterogeneous disorders with multiple genetic and environmental risk factors. {ECO:0000269|PubMed:14681304}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.	NA	2466574; 16710414; 7684381; 7585949; 7585950; 7559387; 11237770; 15769472; 16263699; 18606703; 8901515; 7505680; 11081633; 9668170; 10391209; 14681304
1	173952711	nonsynonymous	A	G	0.484848484848485	1	RC3H1	TRUE	Q5TC82	reviewed	Roquin-1 (Roquin) (RING finger and C3H zinc finger protein 1) (RING finger and CCCH-type zinc finger domain-containing protein 1) (RING finger protein 198)	RC3H1 KIAA2025 RNF198	5 out of 5	TISSUE SPECIFICITY: Widely expressed. Expressed at higher level in cerebellum, spleen, ovary and liver. {ECO:0000269|Ref.3}.	3'-UTR-mediated mRNA destabilization [GO:0061158]; B cell homeostasis [GO:0001782]; cellular response to interleukin-1 [GO:0071347]; cytoplasmic mRNA processing body assembly [GO:0033962]; lymph node development [GO:0048535]; negative regulation of activated T cell proliferation [GO:0046007]; negative regulation of B cell proliferation [GO:0030889]; negative regulation of germinal center formation [GO:0002635]; negative regulation of T-helper cell differentiation [GO:0045623]; nuclear-transcribed mRNA catabolic process [GO:0000956]; nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay [GO:0000288]; positive regulation of mRNA catabolic process [GO:0061014]; positive regulation of NIK/NF-kappaB signaling [GO:1901224]; posttranscriptional regulation of gene expression [GO:0010608]; regulation of germinal center formation [GO:0002634]; regulation of mRNA stability [GO:0043488]; regulation of T cell receptor signaling pathway [GO:0050856]; spleen development [GO:0048536]; T cell homeostasis [GO:0043029]; T cell proliferation [GO:0042098]; T follicular helper cell differentiation [GO:0061470]	NA	NA	14702039; 16710414; 18669648; 23550652; 23186163; 24275569
1	180053158	nonsynonymous	A	C	0.541666666666667	1	CEP350	TRUE	Q5VT06	reviewed	Centrosome-associated protein 350 (Cep350) (Centrosome-associated protein of 350 kDa)	CEP350 CAP350 KIAA0480 GM133	5 out of 5	TISSUE SPECIFICITY: Detected in heart, brain, skeletal muscle, testis, placenta, lung, liver, kidney and pancreas. {ECO:0000269|PubMed:11891061, ECO:0000269|PubMed:15615782}.	microtubule anchoring [GO:0034453]	NA	NA	16710414; 11891061; 14654843; 15615782; 17081983; 16314388; 17878239; 18412956; 19052644; 18669648; 19413330; 20068231; 21269460; 23186163; 24275569; 25134987
1	183184663	nonsynonymous	G	A	0.514285714285714	1	LAMC2	TRUE	Q13753	reviewed	Laminin subunit gamma-2 (Cell-scattering factor 140 kDa subunit) (CSF 140 kDa subunit) (Epiligrin subunit gamma) (Kalinin subunit gamma) (Kalinin/nicein/epiligrin 100 kDa subunit) (Ladsin 140 kDa subunit) (Laminin B2t chain) (Laminin-5 subunit gamma) (Large adhesive scatter factor 140 kDa subunit) (Nicein subunit gamma)	LAMC2 LAMB2T LAMNB2	5 out of 5	TISSUE SPECIFICITY: The large variant is expressed only in specific epithelial cells of embryonic and neonatal tissues. In 17-week old embryo the small variant is found in cerebral cortex, lung, and distal tubes of kidney, but not in epithelia except for distal tubuli.	cell adhesion [GO:0007155]; epidermis development [GO:0008544]; extracellular matrix disassembly [GO:0022617]; extracellular matrix organization [GO:0030198]; hemidesmosome assembly [GO:0031581]	DISEASE: Epidermolysis bullosa, junctional, Herlitz type (H-JEB) [MIM:226700]: An infantile and lethal form of junctional epidermolysis bullosa, a group of blistering skin diseases characterized by tissue separation which occurs within the dermo-epidermal basement In the Herlitz type, death occurs usually within the first six months of life. Occasionally, children survive to teens. It is marked by bullous lesions at birth and extensive denudation of skin and mucous membranes that may be hemorrhagic. {ECO:0000269|PubMed:11810295, ECO:0000269|PubMed:8012393}. Note=The disease is caused by mutations affecting the gene represented in this entry.	79402;79405;79404;	1383240; 8306988; 8786121; 16710414; 15489334; 8265624; 8012393; 11810295; 21269460
1	201009011	nonsynonymous	C	T	0.285714285714286	1	CACNA1S	TRUE	Q13698	reviewed	Voltage-dependent L-type calcium channel subunit alpha-1S (Calcium channel, L type, alpha-1 polypeptide, isoform 3, skeletal muscle) (Voltage-gated calcium channel subunit alpha Cav1.1)	CACNA1S CACH1 CACN1 CACNL1A3	5 out of 5	TISSUE SPECIFICITY: Skeletal muscle specific.	calcium ion transport [GO:0006816]; cardiac conduction [GO:0061337]; membrane depolarization during action potential [GO:0086010]; muscle contraction [GO:0006936]	DISEASE: Periodic paralysis hypokalemic 1 (HOKPP1) [MIM:170400]: An autosomal dominant disorder manifested by episodic flaccid generalized muscle weakness associated with falls of serum potassium levels. {ECO:0000269|PubMed:17418573, ECO:0000269|PubMed:18162704, ECO:0000269|PubMed:19118277, ECO:0000269|PubMed:7987325, ECO:0000269|PubMed:8004673}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Malignant hyperthermia 5 (MHS5) [MIM:601887]: Autosomal dominant disorder that is potentially lethal in susceptible individuals on exposure to commonly used inhalational anesthetics and depolarizing muscle relaxants. {ECO:0000269|PubMed:9199552}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.; DISEASE: Thyrotoxic periodic paralysis 1 (TTPP1) [MIM:188580]: A sporadic muscular disorder characterized by episodic weakness and hypokalemia during a thyrotoxic state. It is clinically similar to hereditary hypokalemic periodic paralysis, except for the fact that hyperthyroidism is an absolute requirement for disease manifestation. The disease presents with recurrent episodes of acute muscular weakness of the four extremities that vary in severity from paresis to complete paralysis. Attacks are triggered by ingestion of a high carbohydrate load or strenuous physical activity followed by a period of rest. Thyrotoxic periodic paralysis can occur in association with any cause of hyperthyroidism, but is most commonly associated with Graves disease. {ECO:0000269|PubMed:15001631}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.	681;423;397755;79102;	7713519; 8838325; 16710414; 15489334; 7916735; 8004673; 15001631; 7987325; 9199552; 18162704; 17418573; 19118277
1	201180652	nonsynonymous	A	G	0.384615384615385	0	IGFN1	TRUE	Q86VF2	reviewed	Immunoglobulin-like and fibronectin type III domain-containing protein 1 (EEF1A2-binding protein 1) (KY-interacting protein 1)	IGFN1 EEF1A2BP1 KYIP1	4 out of 5	TISSUE SPECIFICITY: Expressed in skeletal muscle. {ECO:0000269|PubMed:15385448}.	NA	NA	NA	17974005; 16710414; 15489334; 15385448
1	204924020	nonsynonymous	C	T	0.823529411764706	1	NFASC	TRUE	O94856	reviewed	Neurofascin	NFASC KIAA0756	5 out of 5	NA	axon guidance [GO:0007411]; clustering of voltage-gated sodium channels [GO:0045162]; heterotypic cell-cell adhesion [GO:0034113]; myelination [GO:0042552]; paranodal junction assembly [GO:0030913]; peripheral nervous system development [GO:0007422]; protein localization to juxtaparanode region of axon [GO:0071205]; protein localization to paranode region of axon [GO:0002175]; protein targeting to plasma membrane [GO:0072661]; synapse organization [GO:0050808]; transmission of nerve impulse [GO:0019226]	NA	NA	9872452; 12168954; 14702039; 16710414; 15489334; 15491607; 17974005; 18669648; 23897819; 21047790
1	204944441	nonsynonymous	G	A	0.392857142857143	0	NFASC	TRUE	O94856	reviewed	Neurofascin	NFASC KIAA0756	5 out of 5	NA	axon guidance [GO:0007411]; clustering of voltage-gated sodium channels [GO:0045162]; heterotypic cell-cell adhesion [GO:0034113]; myelination [GO:0042552]; paranodal junction assembly [GO:0030913]; peripheral nervous system development [GO:0007422]; protein localization to juxtaparanode region of axon [GO:0071205]; protein localization to paranode region of axon [GO:0002175]; protein targeting to plasma membrane [GO:0072661]; synapse organization [GO:0050808]; transmission of nerve impulse [GO:0019226]	NA	NA	9872452; 12168954; 14702039; 16710414; 15489334; 15491607; 17974005; 18669648; 23897819; 21047790
1	204944536	nonsynonymous	A	G	0.391304347826087	0.3	NFASC	TRUE	O94856	reviewed	Neurofascin	NFASC KIAA0756	5 out of 5	NA	axon guidance [GO:0007411]; clustering of voltage-gated sodium channels [GO:0045162]; heterotypic cell-cell adhesion [GO:0034113]; myelination [GO:0042552]; paranodal junction assembly [GO:0030913]; peripheral nervous system development [GO:0007422]; protein localization to juxtaparanode region of axon [GO:0071205]; protein localization to paranode region of axon [GO:0002175]; protein targeting to plasma membrane [GO:0072661]; synapse organization [GO:0050808]; transmission of nerve impulse [GO:0019226]	NA	NA	9872452; 12168954; 14702039; 16710414; 15489334; 15491607; 17974005; 18669648; 23897819; 21047790
1	215844373	nonsynonymous	C	T	0.5	1	USH2A	TRUE	O75445	reviewed	Usherin (Usher syndrome type IIa protein) (Usher syndrome type-2A protein)	USH2A	5 out of 5	TISSUE SPECIFICITY: Present in the basement membrane of many, but not all tissues. Expressed in retina, cochlea, small and large intestine, pancreas, bladder, prostate, esophagus, trachea, thymus, salivary glands, placenta, ovary, fallopian tube, uterus and testis. Absent in many other tissues such as heart, lung, liver, kidney and brain. In the retina, it is present in the basement membranes in the Bruch's layer choroid capillary basement membranes, where it localizes just beneath the retinal pigment epithelial cells (at protein level). Weakly expressed. Isoform 2 is expressed in fetal eye, cochlea and heart, and at very low level in brain, CNS, intestine, skeleton, tongue, kidney and lung. Isoform 2 is not expressed in stomach and liver. In adult tissues, isoform 2 is expressed in neural retina and testis, and at low level in brain, heart, kidney and liver. Isoform 1 displays a similar pattern of expression but is expressed at very low level in fetal cochlea. {ECO:0000269|PubMed:11788194, ECO:0000269|PubMed:12433396, ECO:0000269|PubMed:15015129, ECO:0000269|PubMed:9624053}.	establishment of protein localization [GO:0045184]; hair cell differentiation [GO:0035315]; inner ear receptor cell differentiation [GO:0060113]; maintenance of organ identity [GO:0048496]; photoreceptor cell maintenance [GO:0045494]; response to stimulus [GO:0050896]; sensory perception of light stimulus [GO:0050953]; sensory perception of sound [GO:0007605]; visual perception [GO:0007601]	DISEASE: Usher syndrome 2A (USH2A) [MIM:276901]: USH is a genetically heterogeneous condition characterized by the association of retinitis pigmentosa with sensorineural deafness. Age at onset and differences in auditory and vestibular function distinguish Usher syndrome type 1 (USH1), Usher syndrome type 2 (USH2) and Usher syndrome type 3 (USH3). USH2 is characterized by congenital mild hearing impairment with normal vestibular responses. {ECO:0000269|PubMed:10729113, ECO:0000269|PubMed:10738000, ECO:0000269|PubMed:10909849, ECO:0000269|PubMed:11311042, ECO:0000269|PubMed:12112664, ECO:0000269|PubMed:12525556, ECO:0000269|PubMed:14970843, ECO:0000269|PubMed:15015129, ECO:0000269|PubMed:15025721, ECO:0000269|PubMed:15241801, ECO:0000269|PubMed:15325563, ECO:0000269|PubMed:17085681, ECO:0000269|PubMed:17405132, ECO:0000269|PubMed:18273898, ECO:0000269|PubMed:18452394, ECO:0000269|PubMed:19683999, ECO:0000269|PubMed:19737284, ECO:0000269|PubMed:20309401, ECO:0000269|PubMed:20440071, ECO:0000269|PubMed:20507924, ECO:0000269|PubMed:21593743, ECO:0000269|PubMed:21686329, ECO:0000269|PubMed:22004887, ECO:0000269|PubMed:23737954, ECO:0000269|PubMed:26377068, ECO:0000269|PubMed:9624053}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Retinitis pigmentosa 39 (RP39) [MIM:613809]: A retinal dystrophy belonging to the group of pigmentary retinopathies. Retinitis pigmentosa is characterized by retinal pigment deposits visible on fundus examination and primary loss of rod photoreceptor cells followed by secondary loss of cone photoreceptors. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. {ECO:0000269|PubMed:10775529, ECO:0000269|PubMed:12112664, ECO:0000269|PubMed:12427073, ECO:0000269|PubMed:15325563, ECO:0000269|PubMed:16098008, ECO:0000269|PubMed:17296898, ECO:0000269|PubMed:20507924, ECO:0000269|PubMed:21686329, ECO:0000269|PubMed:22334370, ECO:0000269|PubMed:24227914}. Note=The disease is caused by mutations affecting the gene represented in this entry.	791;231178;	9624053; 10729113; 15015129; 16710414; 11788194; 12433396; 14676276; 16114888; 16301217; 16301216; 16434480; 12786748; 18826961; 20440071; 10775529; 10909849; 10738000; 11311042; 12427073; 12112664; 12525556; 15025721; 14970843; 15325563; 15241801; 16098008; 17085681; 17296898; 17405132; 18452394; 18273898; 19737284; 19683999; 20507924; 20309401; 21835308; 21593743; 21686329; 21248752; 22004887; 22334370; 24227914; 23737954; 26377068
1	223284069	nonsynonymous	G	A	0.52	1	TLR5	TRUE	O60602	reviewed	Toll-like receptor 5 (Toll/interleukin-1 receptor-like protein 3)	TLR5 TIL3	5 out of 5	TISSUE SPECIFICITY: Highly expressed in ovary and in peripheral blood leukocytes, especially in monocytes, less in CD11c+ immature dendritic cells. Also detected in prostate and testis.	cellular response to lipopolysaccharide [GO:0071222]; cellular response to mechanical stimulus [GO:0071260]; defense response to Gram-negative bacterium [GO:0050829]; inflammatory response [GO:0006954]; innate immune response [GO:0045087]; male gonad development [GO:0008584]; MyD88-dependent toll-like receptor signaling pathway [GO:0002755]; positive regulation of interleukin-8 production [GO:0032757]; positive regulation of nitric oxide biosynthetic process [GO:0045429]; positive regulation of toll-like receptor signaling pathway [GO:0034123]; regulation of cytokine secretion [GO:0050707]; toll-like receptor 5 signaling pathway [GO:0034146]	DISEASE: Systemic lupus erythematosus 1 (SLEB1) [MIM:601744]: A chronic, relapsing, inflammatory, and often febrile multisystemic disorder of connective tissue, characterized principally by involvement of the skin, joints, kidneys and serosal membranes. It is of unknown etiology, but is thought to represent a failure of the regulatory mechanisms of the autoimmune system. The disease is marked by a wide range of system dysfunctions, an elevated erythrocyte sedimentation rate, and the formation of LE cells in the blood or bone marrow. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.	NA	9596645; 18810425; 19179655; 19924287; 16710414; 15489334; 9435236; 15340161; 11323673; 16027372; 17157808; 17442957; 23447684; 22173220; 14623910
1	228559967	nonsynonymous	C	T	0.352941176470588	0	OBSCN	TRUE	Q5VST9	reviewed	Obscurin (EC 2.7.11.1) (Obscurin-RhoGEF) (Obscurin-myosin light chain kinase) (Obscurin-MLCK)	OBSCN KIAA1556 KIAA1639	5 out of 5	NA	mitophagy in response to mitochondrial depolarization [GO:0098779]; multicellular organism development [GO:0007275]; positive regulation of apoptotic process [GO:0043065]; protein localization to M-band [GO:0036309]; regulation of Rho protein signal transduction [GO:0035023]; regulation of small GTPase mediated signal transduction [GO:0051056]; sarcomere organization [GO:0045214]	DISEASE: Note=A chromosomal aberration involving OBSCN has been found in Wilms tumor. Translocation t(1;7)(q42;p15) with PTHB1. {ECO:0000269|PubMed:12618763}.	NA	11448995; 16710414; 16625316; 10997877; 11717165; 11814696; 12527750; 12618763; 16205939; 23186163; 16959974; 17344846; 25173926
1	229667404	nonsynonymous	C	G	0.6	1	ABCB10	TRUE	Q9NRK6	reviewed	ATP-binding cassette sub-family B member 10, mitochondrial (ATP-binding cassette transporter 10) (ABC transporter 10 protein) (Mitochondrial ATP-binding cassette 2) (M-ABC2)	ABCB10	5 out of 5	TISSUE SPECIFICITY: Ubiquitous. Highly expressed in bone marrow, expressed at intermediate to high levels in skeletal muscle, small intestine, thyroid, heart, brain, placenta, liver, pancreas, prostate, testis, ovary, leukocyte, stomach, spinal cord, lymph node, trachea and adrenal gland, and low levels are found in lung, kidney, spleen, thymus and colon.	transmembrane transport [GO:0055085]; transport [GO:0006810]	NA	NA	10922475; 16710414; 15489334; 7766993; 19608861; 21269460; 24275569; 25944712; 23716676; 11829140; 16959974
1	247013492	nonsynonymous	C	T	0.315789473684211	0	AHCTF1	TRUE	Q8WYP5	reviewed	Protein ELYS (Embryonic large molecule derived from yolk sac) (Protein MEL-28) (Putative AT-hook-containing transcription factor 1)	AHCTF1 ELYS TMBS62 MSTP108	5 out of 5	NA	cytokinesis [GO:0000910]; mRNA transport [GO:0051028]; nuclear pore complex assembly [GO:0051292]; protein transport [GO:0015031]; sister chromatid cohesion [GO:0007062]	NA	NA	11952839; 16710414; 17974005; 15489334; 17081983; 16964243; 17098863; 17235358; 18220336; 18691976; 18669648; 19413330; 19690332; 20068231; 21406692; 23186163; 24275569
1	248458604	nonsynonymous	C	T	0.210526315789474	0	OR2T12	TRUE	Q8NG77	reviewed	Olfactory receptor 2T12 (Olfactory receptor OR1-57)	OR2T12	4 out of 5	NA	G-protein coupled receptor signaling pathway [GO:0007186]; sensory perception of smell [GO:0007608]	NA	NA	16710414; 14983052
1	248801610	nonsynonymous	GC	AT	1	0	OR2T35	TRUE	Q8NGX2	reviewed	Olfactory receptor 2T35 (Olfactory receptor OR1-66)	OR2T35	3 out of 5	NA	G-protein coupled receptor signaling pathway [GO:0007186]; sensory perception of smell [GO:0007608]	NA	NA	14983052
2	17963171	nonsynonymous	C	T	0.523809523809524	0.9	GEN1	TRUE	Q17RS7	reviewed	Flap endonuclease GEN homolog 1 (EC 3.1.-.-)	GEN1	5 out of 5	NA	double-strand break repair via homologous recombination [GO:0000724]; positive regulation of mitotic cell cycle spindle assembly checkpoint [GO:0090267]; regulation of centrosome duplication [GO:0010824]; resolution of mitotic recombination intermediates [GO:0071140]; resolution of recombination intermediates [GO:0071139]	NA	NA	14702039; 15815621; 15489334; 19020614; 16959974; 21248752
2	21225500	nonsynonymous	A	G	0.53125	0	APOB	TRUE	P04114	reviewed	Apolipoprotein B-100 (Apo B-100) [Cleaved into: Apolipoprotein B-48 (Apo B-48)]	APOB	5 out of 5	NA	artery morphogenesis [GO:0048844]; cellular protein catabolic process [GO:0044257]; cellular response to prostaglandin stimulus [GO:0071379]; cellular response to tumor necrosis factor [GO:0071356]; cholesterol efflux [GO:0033344]; cholesterol homeostasis [GO:0042632]; cholesterol metabolic process [GO:0008203]; cholesterol transport [GO:0030301]; fertilization [GO:0009566]; in utero embryonic development [GO:0001701]; leukocyte migration [GO:0050900]; lipoprotein biosynthetic process [GO:0042158]; lipoprotein catabolic process [GO:0042159]; lipoprotein metabolic process [GO:0042157]; lipoprotein transport [GO:0042953]; low-density lipoprotein particle clearance [GO:0034383]; low-density lipoprotein particle remodeling [GO:0034374]; nervous system development [GO:0007399]; positive regulation of cholesterol storage [GO:0010886]; positive regulation of gene expression [GO:0010628]; positive regulation of lipid storage [GO:0010884]; positive regulation of macrophage derived foam cell differentiation [GO:0010744]; post-embryonic development [GO:0009791]; receptor-mediated endocytosis [GO:0006898]; regulation of cholesterol biosynthetic process [GO:0045540]; response to carbohydrate [GO:0009743]; response to lipopolysaccharide [GO:0032496]; response to selenium ion [GO:0010269]; response to virus [GO:0009615]; retinoid metabolic process [GO:0001523]; spermatogenesis [GO:0007283]; sperm motility [GO:0030317]; triglyceride catabolic process [GO:0019433]; triglyceride mobilization [GO:0006642]; very-low-density lipoprotein particle assembly [GO:0034379]	DISEASE: Hypobetalipoproteinemia, familial, 1 (FHBL1) [MIM:615558]: A disorder of lipid metabolism characterized by less than 5th percentile age- and sex-specific levels of low density lipoproteins, and dietary fat malabsorption. Clinical presentation may vary from no symptoms to severe gastrointestinal and neurological dysfunction similar to abetalipoproteinemia. {ECO:0000269|PubMed:12551903, ECO:0000269|PubMed:21981844}. Note=The disease is caused by mutations affecting the gene represented in this entry. Most cases of FHBL1 result from nonsense mutations in the APOB gene that lead to a premature stop codon, which generate prematurely truncated apo B protein products (PubMed:21981844). {ECO:0000269|PubMed:21981844}.; DISEASE: Familial ligand-defective apolipoprotein B-100 (FDB) [MIM:144010]: Dominantly inherited disorder of lipoprotein metabolism leading to hypercholesterolemia and increased proneness to coronary artery disease (CAD). The plasma cholesterol levels are dramatically elevated due to impaired clearance of LDL particles by defective APOB/E receptors. {ECO:0000269|PubMed:21382890, ECO:0000269|PubMed:2563166, ECO:0000269|PubMed:7883971, ECO:0000269|PubMed:9259199}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Note=Defects in APOB associated with defects in other genes (polygenic) can contribute to hypocholesterolemia.	426;406;391665;	3763409; 3652907; 3759943; 3464946; 3030729; 15815621; 3461454; 3513177; 2115173; 3001697; 3860836; 6373369; 2567736; 2883086; 3676265; 3841204; 3621347; 2450346; 3426612; 2445342; 3903660; 2994225; 2932736; 3841481; 3024665; 3659919; 3773997; 3095664; 3087360; 10679026; 14760718; 16335952; 16548883; 19159218; 19608861; 20686565; 21269460; 21981844; 22580899; 24275569; 26091039; 26224785; 1979313; 2563166; 2216805; 7883971; 8889592; 9259199; 9490296; 12551903; 14732481; 16959974; 21382890; 22028381; 22095935
2	27861811	nonsynonymous	A	C	0.529411764705882	1	GPN1	TRUE	Q9HCN4	reviewed	GPN-loop GTPase 1 (EC 3.6.5.-) (MBD2-interacting protein) (MBDin) (RNAPII-associated protein 4) (XPA-binding protein 1)	GPN1 MBDIN RPAP4 XAB1 HUSSY-23	5 out of 5	TISSUE SPECIFICITY: Expressed ubiquitously.	NA	NA	NA	11058119; 14702039; 15815621; 15489334; 11124703; 17643375; 18220336; 18691976; 18669648; 19413330; 20855544; 20864038; 20068231; 21269460; 21844196; 21768307; 21406692; 22223895; 22814378; 23186163; 24275569
2	28824803	nonsynonymous	G	A	0.458333333333333	0	PLB1	TRUE	Q6P1J6	reviewed	Phospholipase B1, membrane-associated (Phospholipase B) (hPLB) (Phospholipase B/lipase) (PLB/LIP) [Includes: Phospholipase A2 (EC 3.1.1.4); Lysophospholipase (EC 3.1.1.5)]	PLB1 PLB	5 out of 5	TISSUE SPECIFICITY: Expressed in the epidermis (at protein level). {ECO:0000269|PubMed:12150957}.	lipid catabolic process [GO:0016042]; phosphatidylcholine acyl-chain remodeling [GO:0036151]; positive regulation of acrosome reaction [GO:2000344]; retinoid metabolic process [GO:0001523]	NA	NA	15815621; 15489334; 14702039; 12150957
2	29455199	nonsynonymous	A	T	0.6	1	ALK	TRUE	Q9UM73	reviewed	ALK tyrosine kinase receptor (EC 2.7.10.1) (Anaplastic lymphoma kinase) (CD antigen CD246)	ALK	5 out of 5	TISSUE SPECIFICITY: Expressed in brain and CNS. Also expressed in the small intestine and testis, but not in normal lymphoid cells. {ECO:0000269|PubMed:9174053}.	activation of MAPK activity [GO:0000187]; cell proliferation [GO:0008283]; neuron development [GO:0048666]; phosphorylation [GO:0016310]; positive regulation of NF-kappaB transcription factor activity [GO:0051092]; protein autophosphorylation [GO:0046777]; regulation of apoptotic process [GO:0042981]; signal transduction [GO:0007165]; transmembrane receptor protein tyrosine kinase signaling pathway [GO:0007169]	DISEASE: Note=A chromosomal aberration involving ALK is found in a form of non-Hodgkin lymphoma. Translocation t(2;5)(p23;q35) with NPM1. The resulting chimeric NPM1-ALK protein homodimerize and the kinase becomes constitutively activated. The constitutively active fusion proteins are responsible for 5-10% of non-Hodgkin lymphomas.; DISEASE: Note=A chromosomal aberration involving ALK is associated with inflammatory myofibroblastic tumors (IMTs). Translocation t(2;11)(p23;p15) with CARS; translocation t(2;4)(p23;q21) with SEC31A.; DISEASE: Note=A chromosomal aberration involving ALK is associated with anaplastic large-cell lymphoma (ALCL). Translocation t(2;17)(p23;q25) with ALO17.; DISEASE: Neuroblastoma 3 (NBLST3) [MIM:613014]: A common neoplasm of early childhood arising from embryonic cells that form the primitive neural crest and give rise to the adrenal medulla and the sympathetic nervous system. {ECO:0000269|PubMed:18724359, ECO:0000269|PubMed:18923523, ECO:0000269|PubMed:18923525}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.; DISEASE: Note=The ALK signaling pathway plays an important role in glioblastoma, the most common malignant brain tumor of adults and one of the most lethal cancers. It regulates both glioblastoma migration and growth.; DISEASE: Note=A chromosomal aberration involving ALK is found in one subject with colorectal cancer. Translocation t(2;2)(p23.1;p23.3). A 5 million base pair tandem duplication generates an in-frame WDCP-ALK gene fusion. {ECO:0000269|PubMed:22327622}.	300895;364043;178342;635;357191;	9174053; 9053841; 15815621; 8122112; 11387242; 11121404; 11278720; 12112524; 11809760; 12107166; 12122009; 15226403; 15938644; 15908427; 16317043; 15592455; 16161041; 17274988; 17681947; 16878150; 19459784; 22327622; 20632993; 20695522; 20454865; 21575866; 17344846; 18724359; 18923523; 18923525; 21242967
2	48808125	nonsynonymous	G	T	0.590909090909091	0.1	STON1-GTF2A1L	TRUE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
2	48808125	nonsynonymous	G	T	0.590909090909091	0.1	STON1	TRUE	Q9Y6Q2	reviewed	Stonin-1 (Stoned B-like factor)	STON1 SALF SBLF STN1	4 out of 5	TISSUE SPECIFICITY: Ubiquitous. {ECO:0000269|PubMed:11381094}.	endocytosis [GO:0006897]; regulation of endocytosis [GO:0030100]	NA	NA	10364255; 11159353; 14702039; 15815621; 15489334; 11381094
2	73928078	nonsynonymous	C	A	0.461538461538462	1	NAT8B	TRUE	Q9UHF3	reviewed	Putative N-acetyltransferase 8B (EC 2.3.1.-) (Acetyltransferase 1) (ATase1) (Camello-like protein 2)	NAT8B CML2	5 out of 5	NA	beta-amyloid metabolic process [GO:0050435]; cellular protein metabolic process [GO:0044267]; gastrulation with mouth forming second [GO:0001702]; negative regulation of apoptotic process [GO:0043066]; peptidyl-lysine N6-acetylation [GO:0018003]; positive regulation of gene expression [GO:0010628]	NA	NA	11397015; 16395595; 19011241; 24556617
2	88409984	nonsynonymous	G	A	0.555555555555556	1	SMYD1	TRUE	Q8NB12	reviewed	Histone-lysine N-methyltransferase SMYD1 (EC 2.1.1.43) (SET and MYND domain-containing protein 1)	SMYD1	5 out of 5	TISSUE SPECIFICITY: Expression seems mostly restricted to heart and skeletal muscle. {ECO:0000269|PubMed:19783823}.	chromatin remodeling [GO:0006338]; heart development [GO:0007507]; negative regulation of transcription, DNA-templated [GO:0045892]; positive regulation of myoblast differentiation [GO:0045663]; positive regulation of myotube differentiation [GO:0010831]; skeletal muscle cell differentiation [GO:0035914]; transcription, DNA-templated [GO:0006351]	NA	NA	14702039; 17974005; 15815621; 15489334; 19783823
2	109382936	nonsynonymous	T	A	0.464285714285714	1	RANBP2	TRUE	P49792	reviewed	E3 SUMO-protein ligase RanBP2 (EC 6.3.2.-) (358 kDa nucleoporin) (Nuclear pore complex protein Nup358) (Nucleoporin Nup358) (Ran-binding protein 2) (RanBP2) (p270)	RANBP2 NUP358	5 out of 5	NA	gene silencing by RNA [GO:0031047]; intracellular transport of virus [GO:0075733]; mitotic nuclear envelope disassembly [GO:0007077]; mRNA export from nucleus [GO:0006406]; negative regulation of glucokinase activity [GO:0033132]; NLS-bearing protein import into nucleus [GO:0006607]; protein folding [GO:0006457]; protein sumoylation [GO:0016925]; regulation of cellular response to heat [GO:1900034]; regulation of gluconeogenesis involved in cellular glucose homeostasis [GO:0090526]; regulation of glucose transport [GO:0010827]; sister chromatid cohesion [GO:0007062]; tRNA export from nucleus [GO:0006409]; viral process [GO:0016032]; viral transcription [GO:0019083]	DISEASE: Encephalopathy, acute, infection-induced, 3 (IIAE3) [MIM:608033]: A rapidly progressive encephalopathy manifesting in susceptible individuals with seizures and coma. It can occur within days in otherwise healthy children after common viral infections such as influenza and parainfluenza, without evidence of viral infection of the brain or inflammatory cell infiltration. Brain T2-weighted magnetic resonance imaging reveals characteristic symmetric lesions present in the thalami, pons and brainstem. {ECO:0000269|PubMed:19118815}. Note=The disease is caused by mutations affecting the gene represented in this entry. Mutations in the RANBP2 gene predispose to IIAE3, but by themselves are insufficient to make the phenotype fully penetrant; additional genetic and environmental factors are required (PubMed:19118815). {ECO:0000269|PubMed:19118815}.	263524;88619;178342;	7775481; 7603572; 15815621; 7724562; 11792325; 12032081; 11839768; 15144186; 15378033; 15388847; 15608651; 16620772; 17081983; 16332688; 16964243; 18220336; 18691976; 18669648; 18318008; 19413330; 18946085; 19690332; 20068231; 21269460; 21406692; 23186163; 24275569; 25218447; 25114211; 25772364; 25755297; 10078529; 15826666; 15931224; 22194619; 22959972; 23353830; 19118815
2	128744480	nonsynonymous	T	C	0.380952380952381	1	SAP130	TRUE	Q9H0E3	reviewed	Histone deacetylase complex subunit SAP130 (130 kDa Sin3-associated polypeptide) (Sin3-associated polypeptide p130)	SAP130	5 out of 5	TISSUE SPECIFICITY: Expressed in various cancer cell ines. {ECO:0000269|PubMed:12724404}.	histone H3 acetylation [GO:0043966]; negative regulation of transcription from RNA polymerase II promoter [GO:0000122]; transcription, DNA-templated [GO:0006351]	NA	NA	12724404; 11230166; 14702039; 15815621; 15489334; 15561718; 18669648; 20068231; 21406692; 23186163; 24275569; 25218447; 25755297
2	131595261	nonsynonymous	C	G	0.5	0	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
2	170558097	nonsynonymous	A	G	0.44	1	PHOSPHO2	TRUE	Q8TCD6	reviewed	Pyridoxal phosphate phosphatase PHOSPHO2 (EC 3.1.3.74)	PHOSPHO2	3 out of 5	NA	NA	NA	NA	14702039; 15815621; 15489334; 16054448
2	170558097	nonsynonymous	A	G	0.44	1	PHOSPHO2-KLHL23	FALSE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
2	215595164	nonsynonymous	G	A	0.5	0.9	BARD1	TRUE	Q99728	reviewed	BRCA1-associated RING domain protein 1 (BARD-1) (EC 6.3.2.-)	BARD1	5 out of 5	NA	cell cycle arrest [GO:0007050]; cellular response to DNA damage stimulus [GO:0006974]; DNA double-strand break processing [GO:0000729]; DNA replication [GO:0006260]; DNA synthesis involved in DNA repair [GO:0000731]; double-strand break repair via nonhomologous end joining [GO:0006303]; negative regulation of apoptotic process [GO:0043066]; negative regulation of mRNA 3'-end processing [GO:0031441]; negative regulation of protein export from nucleus [GO:0046826]; positive regulation of apoptotic process [GO:0043065]; positive regulation of protein catabolic process [GO:0045732]; protein K6-linked ubiquitination [GO:0085020]; protein ubiquitination [GO:0016567]; regulation of phosphorylation [GO:0042325]; regulation of signal transduction by p53 class mediator [GO:1901796]; strand displacement [GO:0000732]; tissue homeostasis [GO:0001894]	NA	145;	8944023; 9425226; 18089818; 15815621; 15489334; 10026184; 10477523; 12890688; 14976165; 17643122; 17370265; 18669648; 19413330; 19261749; 19690332; 20351172; 23186163; 25755297; 11573085; 17550235; 18842000; 18480049
2	234431981	nonsynonymous	G	T	0.666666666666667	0.2	USP40	TRUE	Q9NVE5	reviewed	Ubiquitin carboxyl-terminal hydrolase 40 (EC 3.4.19.12) (Deubiquitinating enzyme 40) (Ubiquitin thioesterase 40) (Ubiquitin-specific-processing protease 40)	USP40	4 out of 5	TISSUE SPECIFICITY: Broadly expressed. {ECO:0000269|PubMed:14715245}.	protein deubiquitination [GO:0016579]; ubiquitin-dependent protein catabolic process [GO:0006511]	NA	NA	14715245; 14702039; 15815621; 15489334; 24275569
3	42680741	nonsynonymous	T	C	0.483870967741935	0	NKTR	TRUE	P30414	reviewed	NK-tumor recognition protein (NK-TR protein) (Natural-killer cells cyclophilin-related protein) [Includes: Putative peptidyl-prolyl cis-trans isomerase (PPIase) (EC 5.2.1.8) (Rotamase)]	NKTR	4 out of 5	NA	protein folding [GO:0006457]	NA	NA	8421688; 17081983; 18669648; 19690332; 20068231; 21406692; 23186163; 24275569; 25218447; 25114211; 25772364; 25755297
3	42680741	nonsynonymous	T	C	0.483870967741935	0	LOC101928323	FALSE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
3	47452311	nonsynonymous	G	T	0.375	0	PTPN23	TRUE	Q9H3S7	reviewed	Tyrosine-protein phosphatase non-receptor type 23 (EC 3.1.3.48) (His domain-containing protein tyrosine phosphatase) (HD-PTP) (Protein tyrosine phosphatase TD14) (PTP-TD14)	PTPN23 KIAA1471	5 out of 5	NA	cilium morphogenesis [GO:0060271]; negative regulation of epithelial cell migration [GO:0010633]; positive regulation of adherens junction organization [GO:1903393]; positive regulation of early endosome to late endosome transport [GO:2000643]; positive regulation of homophilic cell adhesion [GO:1903387]; protein transport [GO:0015031]; ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway [GO:0043162]	NA	NA	11095967; 14702039; 15489334; 10819331; 12168954; 17974005; 18669648; 18434552; 19690332; 20393563; 21179510; 20068231; 21269460; 21757351; 21406692; 23186163; 24275569; 21889351
3	56651167	nonsynonymous	A	G	0.409090909090909	0	CCDC66	TRUE	A2RUB6	reviewed	Coiled-coil domain-containing protein 66	CCDC66	3 out of 5	NA	detection of light stimulus involved in visual perception [GO:0050908]; post-embryonic retina morphogenesis in camera-type eye [GO:0060060]; retinal rod cell development [GO:0046548]	NA	NA	14702039; 16641997; 15489334; 18669648
3	58849343	nonsynonymous	C	T	0.571428571428571	0	C3orf67	TRUE	Q6ZVT6	reviewed	Uncharacterized protein C3orf67	C3orf67	2 out of 5	NA	NA	NA	NA	14702039; 16641997; 15489334
3	58849343	nonsynonymous	C	T	0.571428571428571	0	C3orf67-AS1	FALSE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
3	69097140	nonsynonymous	C	T	0.619047619047619	1	TMF1	TRUE	P82094	reviewed	TATA element modulatory factor (TMF) (Androgen receptor coactivator 160 kDa protein) (Androgen receptor-associated protein of 160 kDa)	TMF1 ARA160	5 out of 5	NA	acrosome assembly [GO:0001675]; cellular response to organic cyclic compound [GO:0071407]; defense response to bacterium [GO:0042742]; Leydig cell differentiation [GO:0033327]; luteinizing hormone secretion [GO:0032275]; negative regulation of apoptotic process [GO:0043066]; negative regulation of gene expression [GO:0010629]; positive regulation of cytokine production [GO:0001819]; positive regulation of testosterone secretion [GO:2000845]; regulation of proteasomal protein catabolic process [GO:0061136]; regulation of transcription, DNA-templated [GO:0006355]; spermatid nucleus differentiation [GO:0007289]; sperm motility [GO:0030317]; transcription from RNA polymerase II promoter [GO:0006366]	NA	NA	1409643; 10428808; 16641997; 15489334; 12044884; 15467733; 17698061; 18691976; 18669648; 19413330; 19690332; 20068231; 21269460; 21406692; 23186163; 24275569
3	121252048	nonsynonymous	T	G	0.482758620689655	0	POLQ	TRUE	O75417	reviewed	DNA polymerase theta (EC 2.7.7.7) (DNA polymerase eta)	POLQ POLH	5 out of 5	TISSUE SPECIFICITY: Highly expressed in testis. {ECO:0000269|PubMed:14576298}.	base-excision repair [GO:0006284]; cellular response to DNA damage stimulus [GO:0006974]; DNA-dependent DNA replication [GO:0006261]; DNA repair [GO:0006281]; double-strand break repair [GO:0006302]; double-strand break repair via alternative nonhomologous end joining [GO:0097681]; double-strand break repair via homologous recombination [GO:0000724]; negative regulation of double-strand break repair via homologous recombination [GO:2000042]; protein homooligomerization [GO:0051260]; somatic hypermutation of immunoglobulin genes [GO:0016446]	DISEASE: Breast cancer (BC) [MIM:114480]: A common malignancy originating from breast epithelial tissue. Breast neoplasms can be distinguished by their histologic pattern. Invasive ductal carcinoma is by far the most common type. Breast cancer is etiologically and genetically heterogeneous. Important genetic factors have been indicated by familial occurrence and bilateral involvement. Mutations at more than one locus can be involved in different families or even in the same case. {ECO:0000269|PubMed:20624954, ECO:0000269|PubMed:20700469, ECO:0000269|PubMed:25409685}. Note=The gene represented in this entry may be involved in disease pathogenesis.	NA	10395804; 14576298; 16641997; 18503084; 19188258; 19608861; 20700469; 20624954; 21050863; 22135286; 25409685; 24648516; 24989122; 25642963; 25643323
3	124515496	nonsynonymous	C	T	0.7	0.4	ITGB5	TRUE	P18084	reviewed	Integrin beta-5	ITGB5	5 out of 5	NA	antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent [GO:0002479]; cell-matrix adhesion [GO:0007160]; endodermal cell differentiation [GO:0035987]; epithelial cell-cell adhesion [GO:0090136]; extracellular matrix organization [GO:0030198]; integrin-mediated signaling pathway [GO:0007229]; muscle contraction [GO:0006936]; stress fiber assembly [GO:0043149]; transforming growth factor beta receptor signaling pathway [GO:0007179]	NA	NA	2328726; 2371275; 2211615; 14702039; 15489334; 15156152; 15611078; 20615244; 23186163; 24275569
3	126730873	nonsynonymous	G	A	0.565217391304348	1	PLXNA1	TRUE	Q9UIW2	reviewed	Plexin-A1 (Semaphorin receptor NOV)	PLXNA1 NOV PLXN1	5 out of 5	TISSUE SPECIFICITY: Detected in fetal brain, lung, liver and kidney. {ECO:0000269|PubMed:8570614}.	branchiomotor neuron axon guidance [GO:0021785]; dichotomous subdivision of terminal units involved in salivary gland branching [GO:0060666]; multicellular organism development [GO:0007275]; neuron projection extension [GO:1990138]; regulation of axon extension involved in axon guidance [GO:0048841]; regulation of cell migration [GO:0030334]; regulation of smooth muscle cell migration [GO:0014910]; semaphorin-plexin signaling pathway involved in axon guidance [GO:1902287]	NA	NA	16641997; 8570614; 14702039; 19349973; 21269460
3	127398955	nonsynonymous	G	A	0.391304347826087	1	ABTB1	TRUE	Q969K4	reviewed	Ankyrin repeat and BTB/POZ domain-containing protein 1 (Elongation factor 1A-binding protein)	ABTB1 BPOZ PP2259	5 out of 5	TISSUE SPECIFICITY: Ubiquitously expressed in all fetal tissues examined including heart, brain, liver, and kidney. Also expressed at lower levels in both adult heart and hypertrophic heart. {ECO:0000269|PubMed:10891360}.	proteasome-mediated ubiquitin-dependent protein catabolic process [GO:0043161]; protein ubiquitination involved in ubiquitin-dependent protein catabolic process [GO:0042787]; regulation of proteolysis [GO:0030162]	NA	NA	10891360; 11494141; 15498874; 14702039; 15489334; 
3	128634098	frameshift	CAGG	CG	0.55	0	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
3	164906038	nonsynonymous	G	A	0.333333333333333	1	SLITRK3	TRUE	O94933	reviewed	SLIT and NTRK-like protein 3	SLITRK3 KIAA0848	3 out of 5	TISSUE SPECIFICITY: Expressed in the occipital lobe of the cerebral cortex of the brain. Expressed at higher levels in some astrocytic brain tumors such as astrocytomas, oligodendrogliomas, glioblastomas, gangliogliomas and primitive neuroectodermal tumors. {ECO:0000269|PubMed:14557068}.	axonogenesis [GO:0007409]; positive regulation of synapse assembly [GO:0051965]	NA	NA	10048485; 14702039; 15489334; 14557068
3	170584249	nonsynonymous	C	A	0.25	1	RPL22L1	TRUE	Q6P5R6	reviewed	60S ribosomal protein L22-like 1	RPL22L1	2 out of 5	NA	cytoplasmic translation [GO:0002181]	NA	NA	15489334; 18669648; 19413330; 19369195; 19690332; 20068231; 21269460; 21406692; 24275569
3	182566330	nonsynonymous	G	T	0.32	1	ATP11B	TRUE	Q9Y2G3	reviewed	Probable phospholipid-transporting ATPase IF (EC 3.6.3.1) (ATPase IR) (ATPase class VI type 11B) (P4-ATPase flippase complex alpha subunit ATP11B)	ATP11B ATPIF ATPIR KIAA0956	5 out of 5	NA	aminophospholipid transport [GO:0015917]; ion transmembrane transport [GO:0034220]; ion transport [GO:0006811]; phospholipid translocation [GO:0045332]	NA	NA	11015572; 16641997; 15489334; 11790799; 10231032; 17974005; 19690332; 21914794; 23585472; 23186163; 24275569
3	183480014	nonsynonymous	G	A	0.428571428571429	1	YEATS2	TRUE	Q9ULM3	reviewed	YEATS domain-containing protein 2	YEATS2 KIAA1197	5 out of 5	NA	histone H3 acetylation [GO:0043966]; negative regulation of transcription, DNA-templated [GO:0045892]; negative regulation of transcription from RNA polymerase II promoter [GO:0000122]	NA	NA	10574462; 16641997; 15489334; 18669648; 19413330; 19103755; 19690332; 20068231; 21406692; 23186163; 24275569; 25114211; 25772364
3	185906117	nonsynonymous	T	C	0.344827586206897	0.9	DGKG	TRUE	P49619	reviewed	Diacylglycerol kinase gamma (DAG kinase gamma) (EC 2.7.1.107) (Diglyceride kinase gamma) (DGK-gamma)	DGKG DAGK3	5 out of 5	TISSUE SPECIFICITY: Predominantly expressed in retina and in a much lesser extent in the brain. Other tissues contain extremely low levels of DGK-gamma.	intracellular signal transduction [GO:0035556]; neuron development [GO:0048666]; platelet activation [GO:0030168]; protein kinase C-activating G-protein coupled receptor signaling pathway [GO:0007205]; signal transduction [GO:0007165]	NA	NA	8034597; 10071200; 14702039; 16641997; 15489334; 16959974
4	673778	nonsynonymous	T	C	0.375	1	MYL5	TRUE	Q02045	reviewed	Myosin light chain 5 (Myosin regulatory light chain 5) (Superfast myosin regulatory light chain 2) (MYLC2) (MyLC-2)	MYL5	4 out of 5	TISSUE SPECIFICITY: Expressed in fetal skeletal muscle and retina.	muscle contraction [GO:0006936]; regulation of muscle contraction [GO:0006937]	NA	NA	1284596; 15489334
4	2195009	nonsynonymous	G	A	0.48	0.9	POLN	TRUE	Q7Z5Q5	reviewed	DNA polymerase nu (EC 2.7.7.7)	POLN	5 out of 5	TISSUE SPECIFICITY: Highly expressed in testis and heart. Weakly expressed in skeletal muscle. {ECO:0000269|PubMed:12794064}.	DNA-dependent DNA replication [GO:0006261]; double-strand break repair via homologous recombination [GO:0000724]; interstrand cross-link repair [GO:0036297]; translesion synthesis [GO:0019985]	NA	NA	12794064; 14702039; 15815621; 
4	13605304	nonsynonymous	G	A	0.3	1	BOD1L1	TRUE	Q8NFC6	reviewed	Biorientation of chromosomes in cell division protein 1-like 1	BOD1L1 BOD1L FAM44A KIAA1327	5 out of 5	NA	cellular response to DNA damage stimulus [GO:0006974]; DNA repair [GO:0006281]; replication fork processing [GO:0031297]	NA	NA	15815621; 15489334; 14702039; 10718198; 12168954; 17974005; 17081983; 16964243; 17370265; 17525332; 18669648; 19413330; 19690332; 19608861; 20068231; 21269460; 21406692; 23186163; 24275569; 16959974; 26166705
4	38775922	nonsense	G	T	0.516129032258065	0	TLR10	TRUE	Q9BXR5	reviewed	Toll-like receptor 10 (CD antigen CD290)	TLR10 UNQ315/PRO358	5 out of 5	TISSUE SPECIFICITY: Highly expressed in spleen, lymph node, thymus, tonsil and at lower levels in lung. Highly expressed in promyelocytic HL-60 cells and in B-cell lines.	immune response [GO:0006955]; inflammatory response [GO:0006954]; innate immune response [GO:0045087]; MyD88-dependent toll-like receptor signaling pathway [GO:0002755]; positive regulation of inflammatory response [GO:0050729]; regulation of cytokine secretion [GO:0050707]; toll-like receptor 10 signaling pathway [GO:0034166]; toll-like receptor signaling pathway [GO:0002224]	NA	NA	11267672; 18810425; 19924287; 12975309; 14702039; 15489334; 18332149
4	74964830	nonsynonymous	C	T	0.428571428571429	0	CXCL2	TRUE	P19875	reviewed	C-X-C motif chemokine 2 (Growth-regulated protein beta) (Gro-beta) (Macrophage inflammatory protein 2-alpha) (MIP2-alpha) [Cleaved into: GRO-beta(5-73) (GRO-beta-T) (Hematopoietic synergistic factor) (HSF) (SB-251353)]	CXCL2 GRO2 GROB MIP2A SCYB2	5 out of 5	NA	chemokine-mediated signaling pathway [GO:0070098]; chemotaxis [GO:0006935]; G-protein coupled receptor signaling pathway [GO:0007186]; immune response [GO:0006955]; inflammatory response [GO:0006954]; positive regulation of neutrophil chemotaxis [GO:0090023]; regulation of cell proliferation [GO:0042127]; response to lipopolysaccharide [GO:0032496]; response to molecule of bacterial origin [GO:0002237]	NA	NA	2201751; 2078213; 2217207; 15489334; 2341726; 10725737; 10600366
4	91230480	nonsynonymous	T	A	0.428571428571429	1	CCSER1	TRUE	Q9C0I3	reviewed	Serine-rich coiled-coil domain-containing protein 1 (Coiled-coil serine-rich protein 1)	CCSER1 FAM190A KIAA1680	2 out of 5	NA	NA	NA	NA	11214970; 15815621; 15489334
4	109086280	nonsynonymous	C	T	0.363636363636364	1	LEF1	TRUE	Q9UJU2	reviewed	Lymphoid enhancer-binding factor 1 (LEF-1) (T cell-specific transcription factor 1-alpha) (TCF1-alpha)	LEF1	5 out of 5	TISSUE SPECIFICITY: Detected in thymus. Not detected in normal colon, but highly expressed in colon cancer biopsies and colon cancer cell lines. Expressed in several pancreatic tumors and weakly expressed in normal pancreatic tissue. Isoforms 1 and 5 are detected in several pancreatic cell lines. {ECO:0000269|PubMed:19653274}.	alpha-beta T cell differentiation [GO:0046632]; anatomical structure regression [GO:0060033]; apoptotic process involved in morphogenesis [GO:0060561]; apoptotic process involved in patterning of blood vessels [GO:1902262]; B cell proliferation [GO:0042100]; beta-catenin-TCF complex assembly [GO:1904837]; BMP signaling pathway [GO:0030509]; canonical Wnt signaling pathway [GO:0060070]; cell chemotaxis [GO:0060326]; cellular response to cytokine stimulus [GO:0071345]; cellular response to interleukin-4 [GO:0071353]; chorio-allantoic fusion [GO:0060710]; dentate gyrus development [GO:0021542]; embryonic limb morphogenesis [GO:0030326]; epithelial to mesenchymal transition [GO:0001837]; eye pigmentation [GO:0048069]; face morphogenesis [GO:0060325]; forebrain neuroblast division [GO:0021873]; forebrain neuron differentiation [GO:0021879]; forebrain radial glial cell differentiation [GO:0021861]; formation of radial glial scaffolds [GO:0021943]; histone H3 acetylation [GO:0043966]; histone H4 acetylation [GO:0043967]; hypothalamus development [GO:0021854]; kidney development [GO:0001822]; mammary gland development [GO:0030879]; muscle fiber development [GO:0048747]; negative regulation of apoptotic process [GO:0043066]; negative regulation of apoptotic process in bone marrow [GO:0071866]; negative regulation of canonical Wnt signaling pathway [GO:0090090]; negative regulation of cell-cell adhesion [GO:0022408]; negative regulation of cysteine-type endopeptidase activity involved in apoptotic process [GO:0043154]; negative regulation of DNA binding [GO:0043392]; negative regulation of estrogen receptor binding [GO:0071899]; negative regulation of interleukin-13 production [GO:0032696]; negative regulation of interleukin-4 production [GO:0032713]; negative regulation of interleukin-5 production [GO:0032714]; negative regulation of striated muscle tissue development [GO:0045843]; negative regulation of transcription, DNA-templated [GO:0045892]; negative regulation of transcription from RNA polymerase II promoter [GO:0000122]; neural crest cell migration [GO:0001755]; neutrophil differentiation [GO:0030223]; odontoblast differentiation [GO:0071895]; odontogenesis of dentin-containing tooth [GO:0042475]; organ regeneration [GO:0031100]; osteoblast differentiation [GO:0001649]; palate development [GO:0060021]; paraxial mesoderm formation [GO:0048341]; patterning of blood vessels [GO:0001569]; positive regulation by host of viral transcription [GO:0043923]; positive regulation of cell-cell adhesion [GO:0022409]; positive regulation of cell cycle process [GO:0090068]; positive regulation of cell growth [GO:0030307]; positive regulation of cell migration [GO:0030335]; positive regulation of cell proliferation [GO:0008284]; positive regulation of cell proliferation in bone marrow [GO:0071864]; positive regulation of epithelial to mesenchymal transition [GO:0010718]; positive regulation of gene expression [GO:0010628]; positive regulation of granulocyte differentiation [GO:0030854]; positive regulation of transcription, DNA-templated [GO:0045893]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; regulation of cell-cell adhesion [GO:0022407]; regulation of striated muscle tissue development [GO:0016202]; response to lithium ion [GO:0010226]; sensory perception of taste [GO:0050909]; skin development [GO:0043588]; somitogenesis [GO:0001756]; sprouting angiogenesis [GO:0002040]; T cell receptor V(D)J recombination [GO:0033153]; T-helper 1 cell differentiation [GO:0045063]; tongue development [GO:0043586]; trachea gland development [GO:0061153]; transcription from RNA polymerase II promoter [GO:0006366]; Wnt signaling pathway [GO:0016055]; Wnt signaling pathway, calcium modulating pathway [GO:0007223]	NA	NA	2010090; 10756202; 19653274; 14702039; 15815621; 15489334; 9119228; 9488439; 9751710; 11326276; 11266540; 12192039; 12556497; 14759258; 19690332; 16959974
4	152096180	nonsynonymous	T	C	0.521739130434783	0	SH3D19	TRUE	Q5HYK7	reviewed	SH3 domain-containing protein 19 (ADAM-binding protein Eve-1) (EEN-binding protein) (EBP)	SH3D19	5 out of 5	TISSUE SPECIFICITY: Widely expressed with highest levels in heart, skeletal muscle, kidney, liver, placenta, small intestine and lung. Expressed at low levels in colon, thymus, spleen and leukocytes. {ECO:0000269|PubMed:15280379}.	cytoskeleton organization [GO:0007010]; positive regulation of membrane protein ectodomain proteolysis [GO:0051044]; regulation of cell morphogenesis [GO:0022604]	NA	NA	14702039; 17974005; 15815621; 15489334; 14551139; 15280379; 18669648; 21834987; 24275569
4	152571730	nonsynonymous	G	T	0.617647058823529	0.3	FAM160A1	TRUE	Q05DH4	reviewed	Protein FAM160A1	FAM160A1	2 out of 5	NA	NA	NA	NA	15815621; 14702039; 15489334
4	154519764	nonsynonymous	A	G	0.533333333333333	1	KIAA0922	TRUE	A2VDJ0	reviewed	Transmembrane protein 131-like	KIAA0922 TMEM131L	5 out of 5	TISSUE SPECIFICITY: Expressed in thymocytes. {ECO:0000269|PubMed:23690469}.	negative regulation of canonical Wnt signaling pathway [GO:0090090]; negative regulation of immature T cell proliferation in thymus [GO:0033088]; Wnt signaling pathway [GO:0016055]	NA	NA	11230166; 15815621; 14702039; 15489334; 10231032; 18669648; 19690332; 21269460; 23690469
4	170398474	nonsynonymous	A	C	0.538461538461538	1	NEK1	TRUE	Q96PY6	reviewed	Serine/threonine-protein kinase Nek1 (EC 2.7.11.1) (Never in mitosis A-related kinase 1) (NimA-related protein kinase 1) (Renal carcinoma antigen NY-REN-55)	NEK1 KIAA1901	5 out of 5	TISSUE SPECIFICITY: High fetal expression in the brain and kidney. {ECO:0000269|PubMed:21211617}.	cell division [GO:0051301]; cilium assembly [GO:0042384]; mitotic nuclear division [GO:0007067]; protein phosphorylation [GO:0006468]	DISEASE: Short-rib thoracic dysplasia 6 with or without polydactyly (SRTD6) [MIM:263520]: A form of short-rib thoracic dysplasia, a group of autosomal recessive ciliopathies that are characterized by a constricted thoracic cage, short ribs, shortened tubular bones, and a 'trident' appearance of the acetabular roof. Polydactyly is variably present. Non-skeletal involvement can include cleft lip/palate as well as anomalies of major organs such as the brain, eye, heart, kidneys, liver, pancreas, intestines, and genitalia. Some forms of the disease are lethal in the neonatal period due to respiratory insufficiency secondary to a severely restricted thoracic cage, whereas others are compatible with life. Disease spectrum encompasses Ellis-van Creveld syndrome, asphyxiating thoracic dystrophy (Jeune syndrome), Mainzer-Saldino syndrome, and short rib-polydactyly syndrome. {ECO:0000269|PubMed:22499340}. Note=The disease is caused by mutations affecting the gene represented in this entry. In some cases NEK1 mutations result in disease phenotype in the presence of mutations in DYNC2H1 indicating digenic inheritance (digenic short rib-polydactyly syndrome 3/6 with polydactyly) (PubMed:21211617). {ECO:0000269|PubMed:21211617}.	93269;	11572484; 17974005; 15815621; 15489334; 14702039; 10508479; 18691976; 18669648; 19369195; 20230784; 21211617; 21269460; 23186163; 24275569; 26167768; 17344846; 22499340
4	170990375	nonsynonymous	C	T	0.538461538461538	0.1	AADAT	TRUE	Q8N5Z0	reviewed	Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial (KAT/AadAT) (2-aminoadipate aminotransferase) (2-aminoadipate transaminase) (EC 2.6.1.39) (Alpha-aminoadipate aminotransferase) (AadAT) (Kynurenine aminotransferase II) (Kynurenine--oxoglutarate aminotransferase II) (Kynurenine--oxoglutarate transaminase 2) (EC 2.6.1.7) (Kynurenine--oxoglutarate transaminase II)	AADAT KAT2	5 out of 5	TISSUE SPECIFICITY: Higher expression in the liver. Also found in heart, brain, kidney, pancreas, prostate, testis and ovary.	2-oxoglutarate metabolic process [GO:0006103]; biosynthetic process [GO:0009058]; glutamate metabolic process [GO:0006536]; kynurenine metabolic process [GO:0070189]; L-lysine catabolic process to acetyl-CoA via saccharopine [GO:0033512]; lysine catabolic process [GO:0006554]; tryptophan catabolic process [GO:0006569]; tryptophan catabolic process to kynurenine [GO:0019441]	NA	NA	12126930; 14702039; 15489334; 24275569; 18620547; 18056995; 18056996
4	187207613	nonsynonymous	G	A	0.5	0	F11	TRUE	P03951	reviewed	Coagulation factor XI (FXI) (EC 3.4.21.27) (Plasma thromboplastin antecedent) (PTA) [Cleaved into: Coagulation factor XIa heavy chain; Coagulation factor XIa light chain]	F11	5 out of 5	TISSUE SPECIFICITY: Isoform 2 is produced by platelets and megakaryocytes but absent from other blood cells.	blood coagulation [GO:0007596]; blood coagulation, intrinsic pathway [GO:0007597]; plasminogen activation [GO:0031639]; positive regulation of fibrinolysis [GO:0051919]	DISEASE: Factor XI deficiency (FA11D) [MIM:612416]: A hemorrhagic disease characterized by reduced levels and activity of factor XI resulting in moderate bleeding symptoms, usually occurring after trauma or surgery. Patients usually do not present spontaneous bleeding but women can present with menorrhagia. Hemorrhages are usually moderate. {ECO:0000269|PubMed:10027710, ECO:0000269|PubMed:10606881, ECO:0000269|PubMed:11895778, ECO:0000269|PubMed:15026311, ECO:0000269|PubMed:15180874, ECO:0000269|PubMed:1547342, ECO:0000269|PubMed:15953011, ECO:0000269|PubMed:16607084, ECO:0000269|PubMed:18005151, ECO:0000269|PubMed:21457405, ECO:0000269|PubMed:21668437, ECO:0000269|PubMed:21999818, ECO:0000269|PubMed:22016685, ECO:0000269|PubMed:22159456, ECO:0000269|PubMed:22322133, ECO:0000269|PubMed:2813350, ECO:0000269|PubMed:7669672, ECO:0000269|PubMed:7888672, ECO:0000269|PubMed:9401068, ECO:0000269|PubMed:9787168}. Note=The disease is caused by mutations affecting the gene represented in this entry.	329;	3636155; 2827746; 9593722; 15815621; 15489334; 1998667; 2844223; 11412111; 16335952; 19159218; 25092234; 18510371; 2813350; 1547342; 7888672; 7669672; 9401068; 9787168; 10027710; 10606881; 10391209; 11895778; 15026311; 15180874; 15953011; 16607084; 18005151; 21668437; 21457405; 22016685; 22322133; 21999818; 22159456
4	187207613	nonsynonymous	G	A	0.5	0	F11-AS1	FALSE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
5	16701497	nonsynonymous	C	T	0.5	1	MYO10	TRUE	Q9HD67	reviewed	Unconventional myosin-X (Unconventional myosin-10)	MYO10 KIAA0799	5 out of 5	TISSUE SPECIFICITY: Ubiquitous. {ECO:0000269|PubMed:10984435}.	cytoskeleton-dependent intracellular transport [GO:0030705]; Fc-gamma receptor signaling pathway involved in phagocytosis [GO:0038096]; positive regulation of cell-cell adhesion [GO:0022409]; regulation of cell shape [GO:0008360]; regulation of filopodium assembly [GO:0051489]	NA	NA	10984435; 11278607; 9872452; 15372022; 15489334; 10610710; 17081983; 16371656; 16894163; 18570893; 20682791; 22814378; 21642953; 21321230; 23012428
5	31532534	nonsynonymous	G	C	0.571428571428571	0.9	C5orf22	TRUE	Q49AR2	reviewed	UPF0489 protein C5orf22	C5orf22	2 out of 5	NA	NA	NA	NA	14702039; 17974005; 15489334; 18669648; 19413330
5	33546207	nonsynonymous	T	C	0.357142857142857	1	ADAMTS12	TRUE	P58397	reviewed	A disintegrin and metalloproteinase with thrombospondin motifs 12 (ADAM-TS 12) (ADAM-TS12) (ADAMTS-12) (EC 3.4.24.-)	ADAMTS12 UNQ1918/PRO4389	5 out of 5	TISSUE SPECIFICITY: Expressed in skeletal muscle and fat. Detected at significant levels in fetal lung. Widely expressed in gastric carcinomas and in cancer cells of diverse origin. {ECO:0000269|PubMed:11279086, ECO:0000269|PubMed:16611630}.	cell-matrix adhesion [GO:0007160]; cell migration [GO:0016477]; cellular response to BMP stimulus [GO:0071773]; cellular response to interleukin-1 [GO:0071347]; cellular response to tumor necrosis factor [GO:0071356]; negative regulation of cellular response to hepatocyte growth factor stimulus [GO:2001113]; negative regulation of cellular response to vascular endothelial growth factor stimulus [GO:1902548]; negative regulation of chondrocyte differentiation [GO:0032331]; negative regulation of hepatocyte growth factor receptor signaling pathway [GO:1902203]; proteoglycan catabolic process [GO:0030167]; proteolysis involved in cellular protein catabolic process [GO:0051603]; regulation of endothelial tube morphogenesis [GO:1901509]; regulation of inflammatory response [GO:0050727]	NA	NA	11279086; 12975309; 15372022; 15489334; 16611630; 17895370; 18485748
5	66441069	nonsynonymous	G	A	0.565217391304348	1	MAST4	TRUE	O15021	reviewed	Microtubule-associated serine/threonine-protein kinase 4 (EC 2.7.11.1)	MAST4 KIAA0303	5 out of 5	TISSUE SPECIFICITY: Highly expressed in most normal human tissues, with an exception of in testis, small intestine, colon and peripheral blood leukocyte. {ECO:0000269|PubMed:17086981}.	intracellular signal transduction [GO:0035556]; peptidyl-serine phosphorylation [GO:0018105]	NA	NA	17086981; 15372022; 15489334; 14702039; 9205841; 22814378; 23186163; 24275569; 17344846
5	74675250	nonsynonymous	T	C	0.5	1	COL4A3BP	TRUE	Q9Y5P4	reviewed	Collagen type IV alpha-3-binding protein (Ceramide transfer protein) (hCERT) (Goodpasture antigen-binding protein) (GPBP) (START domain-containing protein 11) (StARD11) (StAR-related lipid transfer protein 11)	COL4A3BP CERT STARD11	5 out of 5	TISSUE SPECIFICITY: Widely expressed.	cell morphogenesis [GO:0000902]; cell proliferation [GO:0008283]; ceramide metabolic process [GO:0006672]; endoplasmic reticulum organization [GO:0007029]; ER to Golgi ceramide transport [GO:0035621]; heart morphogenesis [GO:0003007]; immune response [GO:0006955]; in utero embryonic development [GO:0001701]; lipid homeostasis [GO:0055088]; mitochondrion morphogenesis [GO:0070584]; muscle contraction [GO:0006936]; protein phosphorylation [GO:0006468]; response to endoplasmic reticulum stress [GO:0034976]; signal transduction [GO:0007165]; sphingolipid biosynthetic process [GO:0030148]	DISEASE: Mental retardation, autosomal dominant 34 (MRD34) [MIM:616351]: A form of mental retardation, a disorder characterized by significantly below average general intellectual functioning associated with impairments in adaptive behavior and manifested during the developmental period. {ECO:0000269|PubMed:25533962}. Note=The disease is caused by mutations affecting the gene represented in this entry.	NA	10212244; 11007769; 14685229; 14702039; 15372022; 15489334; 17081983; 16895911; 17591919; 18669648; 19005213; 19690332; 21269460; 23186163; 24275569; 25533962; 18184806; 20036255; 23033978
5	81601230	nonsynonymous	T	C	0.45	0	ATP6AP1L	TRUE	Q52LC2	reviewed	V-type proton ATPase subunit S1-like protein (Vacuolar proton pump subunit S1-like protein)	ATP6AP1L	2 out of 5	NA	ATP hydrolysis coupled proton transport [GO:0015991]	NA	NA	15489334
5	154395970	nonsynonymous	A	G	0.476190476190476	1	KIF4B	TRUE	Q2VIQ3	reviewed	Chromosome-associated kinesin KIF4B (Chromokinesin-B)	KIF4B	5 out of 5	TISSUE SPECIFICITY: Specifically expressed in testis. {ECO:0000269|PubMed:16201836}.	antigen processing and presentation of exogenous peptide antigen via MHC class II [GO:0019886]; microtubule-based movement [GO:0007018]; mitotic cytokinesis [GO:0000281]; mitotic spindle midzone assembly [GO:0051256]; retrograde vesicle-mediated transport, Golgi to ER [GO:0006890]	NA	NA	10978527; 15372022; 16201836
5	160114898	nonsynonymous	C	T	0.578947368421053	0	ATP10B	TRUE	O94823	reviewed	Probable phospholipid-transporting ATPase VB (EC 3.6.3.1) (ATPase class V type 10B) (P4-ATPase flippase complex alpha subunit ATP10B)	ATP10B ATPVB KIAA0715	5 out of 5	TISSUE SPECIFICITY: Found in brain and in low levels in testis.	phospholipid translocation [GO:0045332]	NA	NA	9872452; 14702039; 15372022
5	162909667	nonsynonymous	A	G	0.518518518518518	0.5	HMMR	TRUE	O75330	reviewed	Hyaluronan mediated motility receptor (Intracellular hyaluronic acid-binding protein) (Receptor for hyaluronan-mediated motility) (CD antigen CD168)	HMMR IHABP RHAMM	5 out of 5	TISSUE SPECIFICITY: Expressed in breast cancer cell lines and in normal breast tissue.	G2/M transition of mitotic cell cycle [GO:0000086]; hyaluronan catabolic process [GO:0030214]	NA	NA	8890751; 9601098; 14702039; 15372022; 15489334; 18669648; 21269460; 23186163
5	162909667	nonsynonymous	A	G	0.518518518518518	0.5	HMMR-AS1	TRUE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
5	167489170	nonsynonymous	A	G	0.571428571428571	1	TENM2	TRUE	Q9NT68	reviewed	Teneurin-2 (Ten-2) (Protein Odd Oz/ten-m homolog 2) (Tenascin-M2) (Ten-m2) (Teneurin transmembrane protein 2) [Cleaved into: Ten-2, soluble form; Ten-2 intracellular domain (Ten-2 ICD)]	TENM2 KIAA1127 ODZ2 TNM2	5 out of 5	TISSUE SPECIFICITY: Highly expressed in heart, followed by brain, liver, kidney and fetal brain and weakly expressed in lung and testis. No expression was detected in skeletal muscle, pancreas, spleen, ovary and fetal liver. {ECO:0000269|PubMed:10574461}.	axon guidance [GO:0007411]; calcium-mediated signaling using intracellular calcium source [GO:0035584]; heterophilic cell-cell adhesion via plasma membrane cell adhesion molecules [GO:0007157]; negative regulation of transcription from RNA polymerase II promoter [GO:0000122]; positive regulation of filopodium assembly [GO:0051491]; self proteolysis [GO:0097264]; signal transduction [GO:0007165]; single organismal cell-cell adhesion [GO:0016337]; transcription, DNA-templated [GO:0006351]	NA	NA	15372022; 10574461; 17974005; 21724987
5	176008539	nonsynonymous	G	A	0.421052631578947	0	CDHR2	TRUE	Q9BYE9	reviewed	Cadherin-related family member 2 (Protocadherin LKC) (PC-LKC) (Protocadherin-24)	CDHR2 PCDH24 PCLKC	5 out of 5	TISSUE SPECIFICITY: Highly expressed in liver, kidney and colon. Moderately expressed in small intestine. Down-regulated in a number of liver and colon cancers (PubMed:12117771, PubMed:15534908). Expressed in duodenum with higher expression in enterocytes along the villus axis and lower expression in crypts (at protein level) (PubMed:24725409). {ECO:0000269|PubMed:12117771, ECO:0000269|PubMed:15534908, ECO:0000269|PubMed:24725409}.	cell-cell adhesion mediated by cadherin [GO:0044331]; epithelial cell differentiation [GO:0030855]; homophilic cell adhesion via plasma membrane adhesion molecules [GO:0007156]; intermicrovillar adhesion [GO:0090675]; negative regulation of cell growth involved in contact inhibition [GO:0060243]; regulation of microvillus length [GO:0032532]	NA	NA	12117771; 14702039; 15372022; 15489334; 15534908; 24725409; 24275569; 26812017; 26812018; 18987736
5	176734648	nonsynonymous	G	A	0.533333333333333	0	MXD3	FALSE	Q9BW11	reviewed	Max dimerization protein 3 (Max dimerizer 3) (Class C basic helix-loop-helix protein 13) (bHLHc13) (Max-associated protein 3) (Max-interacting transcriptional repressor MAD3) (Myx)	MXD3 BHLHC13 MAD3	4 out of 5	NA	negative regulation of transcription, DNA-templated [GO:0045892]; transcription, DNA-templated [GO:0006351]	NA	NA	14702039; 17974005; 15372022; 15489334
5	177580532	nonsynonymous	C	T	0.304347826086957	1	NHP2	TRUE	Q9NX24	reviewed	H/ACA ribonucleoprotein complex subunit 2 (Nucleolar protein family A member 2) (snoRNP protein NHP2)	NHP2 NOLA2 HSPC286	5 out of 5	TISSUE SPECIFICITY: Expressed in brain, colon, heart, kidney, ovary, pancreas, placenta, prostate, skeletal muscle, small intestine, spleen, testis and thymus. Also expressed at lower levels in the liver. {ECO:0000269|PubMed:12020816}.	cleavage involved in rRNA processing [GO:0000469]; maturation of LSU-rRNA [GO:0000470]; positive regulation of telomerase RNA localization to Cajal body [GO:1904874]; rRNA pseudouridine synthesis [GO:0031118]; snRNA pseudouridine synthesis [GO:0031120]; telomere maintenance via telomerase [GO:0007004]; translation [GO:0006412]	DISEASE: Dyskeratosis congenita, autosomal recessive, 2 (DKCB2) [MIM:613987]: A rare multisystem disorder caused by defective telomere maintenance. It is characterized by progressive bone marrow failure, and the clinical triad of reticulated skin hyperpigmentation, nail dystrophy, and mucosal leukoplakia. Common but variable features include premature graying, aplastic anemia, low platelets, osteoporosis, pulmonary fibrosis, and liver fibrosis among others. Early mortality is often associated with bone marrow failure, infections, fatal pulmonary complications, or malignancy. {ECO:0000269|PubMed:18523010}. Note=The disease is caused by mutations affecting the gene represented in this entry.	1775;	11074001; 12020816; 11042152; 14702039; 15372022; 15489334; 11790298; 12429849; 15044956; 19179534; 20797632; 20068231; 21269460; 22814378; 24275569; 25218447; 25114211; 25772364; 25755297; 18523010
5	178035455	nonsynonymous	T	A	0.586206896551724	1	CLK4	TRUE	Q9HAZ1	reviewed	Dual specificity protein kinase CLK4 (EC 2.7.12.1) (CDC-like kinase 4)	CLK4	5 out of 5	TISSUE SPECIFICITY: Expressed in liver, kidney, heart, muscle, brain and endothelial cells. {ECO:0000269|PubMed:11170754, ECO:0000269|PubMed:19168442}.	protein autophosphorylation [GO:0046777]; regulation of RNA splicing [GO:0043484]	NA	NA	11170754; 12824502; 12705895; 17081983; 18691976; 18669648; 19168442; 19369195; 23186163; 17344846
5	179193323	nonsynonymous	A	G	0.8	1	MAML1	TRUE	Q92585	reviewed	Mastermind-like protein 1 (Mam-1)	MAML1 KIAA0200	5 out of 5	TISSUE SPECIFICITY: Widely expressed with highest levels in heart, pancreas, peripheral blood leukocytes and spleen. {ECO:0000269|PubMed:11101851}.	atrioventricular node cell development [GO:0060928]; atrioventricular node development [GO:0003162]; myoblast differentiation [GO:0045445]; Notch signaling pathway [GO:0007219]; positive regulation of myotube differentiation [GO:0010831]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; positive regulation of transcription of Notch receptor target [GO:0007221]; protein phosphorylation [GO:0006468]; transcription initiation from RNA polymerase II promoter [GO:0006367]	NA	NA	8724849; 11101851; 11390662; 12050117; 15546612; 17317671; 19690332; 19608861; 23186163; 16530044
5	179407158	nonsynonymous	T	C	0.625	1	RNF130	TRUE	Q86XS8	reviewed	E3 ubiquitin-protein ligase RNF130 (EC 6.3.2.-) (Goliath homolog) (H-Goliath) (RING finger protein 130)	RNF130	5 out of 5	TISSUE SPECIFICITY: Ubiquitously expressed. Highly expressed in leukocytes. Not expressed in erythroblasts. {ECO:0000269|PubMed:16549277}.	apoptotic process [GO:0006915]; programmed cell death [GO:0012501]	NA	NA	13679316; 15372022; 15489334; 16549277; 19159218; 19690332
6	30024752	frameshift	ATTTTTCCTA	ATTTTCCTA	0.423076923076923	1	ZNRD1ASP	FALSE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
6	31525973	nonsynonymous	G	A	0.588235294117647	1	NFKBIL1	TRUE	Q9UBC1	reviewed	NF-kappa-B inhibitor-like protein 1 (Inhibitor of kappa B-like protein) (I-kappa-B-like protein) (IkappaBL) (Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1)	NFKBIL1 IKBL	5 out of 5	TISSUE SPECIFICITY: Detected in different cell types including monocytes, T-cells, B-cells and hepatocytes.	cellular response to lipopolysaccharide [GO:0071222]; cytoplasmic sequestering of transcription factor [GO:0042994]; I-kappaB kinase/NF-kappaB signaling [GO:0007249]; negative regulation of lipopolysaccharide-mediated signaling pathway [GO:0031665]; negative regulation of NF-kappaB transcription factor activity [GO:0032088]; negative regulation of toll-like receptor signaling pathway [GO:0034122]; negative regulation of tumor necrosis factor production [GO:0032720]	DISEASE: Rheumatoid arthritis (RA) [MIM:180300]: An inflammatory disease with autoimmune features and a complex genetic component. It primarily affects the joints and is characterized by inflammatory changes in the synovial membranes and articular structures, widespread fibrinoid degeneration of the collagen fibers in mesenchymal tissues, and by atrophy and rarefaction of bony structures. {ECO:0000305|PubMed:12509789}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.	NA	8081366; 9480751; 10369924; 10202016; 14702039; 14574404; 15489334; 18691976; 20829348; 12509789
6	32170247	nonsynonymous	C	T	0.714285714285714	0	NOTCH4	TRUE	Q99466	reviewed	Neurogenic locus notch homolog protein 4 (Notch 4) (hNotch4) [Cleaved into: Notch 4 extracellular truncation; Notch 4 intracellular domain]	NOTCH4 INT3	5 out of 5	TISSUE SPECIFICITY: Highly expressed in the heart, moderately in the lung and placenta and at low levels in the liver, skeletal muscle, kidney, pancreas, spleen, lymph node, thymus, bone marrow and fetal liver. No expression was seen in adult brain or peripheral blood leukocytes.	cell differentiation [GO:0030154]; cell fate determination [GO:0001709]; embryo development [GO:0009790]; endothelial cell morphogenesis [GO:0001886]; hemopoiesis [GO:0030097]; mammary gland development [GO:0030879]; morphogenesis of a branching structure [GO:0001763]; negative regulation of cell differentiation [GO:0045596]; negative regulation of endothelial cell differentiation [GO:0045602]; Notch receptor processing [GO:0007220]; Notch signaling pathway [GO:0007219]; patterning of blood vessels [GO:0001569]; positive regulation of transcription, DNA-templated [GO:0045893]; positive regulation of transcription of Notch receptor target [GO:0007221]; transcription initiation from RNA polymerase II promoter [GO:0006367]	NA	NA	9168133; 9693032; 14574404; 10079256; 11101851; 12370315
6	40360265	nonsynonymous	G	A	0.5	0.1	LRFN2	TRUE	Q9ULH4	reviewed	Leucine-rich repeat and fibronectin type-III domain-containing protein 2 (Synaptic adhesion-like molecule 1)	LRFN2 KIAA1246 SALM1	5 out of 5	NA	axonogenesis [GO:0007409]; synaptic transmission [GO:0007268]	NA	NA	10574462; 14702039; 14574404; 15489334; 16630835
6	46620240	nonsynonymous	C	T	0.28	0	CYP39A1	TRUE	Q9NYL5	reviewed	24-hydroxycholesterol 7-alpha-hydroxylase (EC 1.14.14.26) (Cytochrome P450 39A1) (hCYP39A1) (Oxysterol 7-alpha-hydroxylase)	CYP39A1	5 out of 5	TISSUE SPECIFICITY: Liver specific.	bile acid biosynthetic process [GO:0006699]; bile acid catabolic process [GO:0030573]; cholesterol catabolic process [GO:0006707]; digestion [GO:0007586]; sterol metabolic process [GO:0016125]	NA	NA	10748047; 14702039; 14574404; 15489334
6	58285389	nonsynonymous	C	T	0.642857142857143	1	LINC00680-GUSBP4	FALSE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
6	58285389	nonsynonymous	C	T	0.642857142857143	1	LINC00680	FALSE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
6	107103544	nonsynonymous	G	A	0.516129032258065	1	QRSL1	TRUE	Q9H0R6	reviewed	Glutamyl-tRNA(Gln) amidotransferase subunit A, mitochondrial (Glu-AdT subunit A) (EC 6.3.5.7) (Glutaminyl-tRNA synthase-like protein 1)	QRSL1	5 out of 5	NA	glutaminyl-tRNAGln biosynthesis via transamidation [GO:0070681]; mitochondrial translation [GO:0032543]; regulation of protein stability [GO:0031647]	NA	NA	11230166; 14702039; 14574404; 15489334; 19805282; 21269460
6	111587204	nonsynonymous	A	G	0.529411764705882	0	MFSD4B	TRUE	Q5TF39	reviewed	Sodium-dependent glucose transporter 1 (Major facilitator superfamily domain-containing protein 4B)	MFSD4B KIAA1919 NAGLT1 HSPC100	3 out of 5	NA	carbohydrate transport [GO:0008643]; sodium ion transport [GO:0006814]	NA	NA	14702039; 14574404; 15489334; 11572484; 
6	151894567	nonsynonymous	G	A	0.620689655172414	1	CCDC170	TRUE	Q8IYT3	reviewed	Coiled-coil domain-containing protein 170	CCDC170 C6orf97	2 out of 5	NA	NA	NA	NA	14702039; 14574404; 15489334
7	5460136	nonsynonymous	G	A	0.409090909090909	0	TNRC18	FALSE	O15417	reviewed	Trinucleotide repeat-containing gene 18 protein (Long CAG trinucleotide repeat-containing gene 79 protein)	TNRC18 CAGL79 KIAA1856	5 out of 5	NA	chromatin silencing [GO:0006342]; heterochromatin assembly [GO:0031507]	NA	NA	12853948; 14702039; 11347906; 9225980; 17370265; 18669648; 19690332; 20068231; 23186163; 24275569
7	33028183	nonsynonymous	G	A	0.611111111111111	1	FKBP9	TRUE	O95302	reviewed	Peptidyl-prolyl cis-trans isomerase FKBP9 (PPIase FKBP9) (EC 5.2.1.8) (63 kDa FK506-binding protein) (63 kDa FKBP) (FKBP-63) (FK506-binding protein 9) (FKBP-9) (Rotamase)	FKBP9 FKBP60 FKBP63	5 out of 5	NA	chaperone-mediated protein folding [GO:0061077]; protein folding [GO:0006457]	NA	NA	14702039; 12853948; 15489334; 10524204; 12754519; 21269460
7	39991306	nonsynonymous	C	G	0.454545454545455	1	CDK13	TRUE	Q14004	reviewed	Cyclin-dependent kinase 13 (EC 2.7.11.22) (EC 2.7.11.23) (CDC2-related protein kinase 5) (Cell division cycle 2-like protein kinase 5) (Cell division protein kinase 13) (hCDK13) (Cholinesterase-related cell division controller)	CDK13 CDC2L CDC2L5 CHED KIAA1791	5 out of 5	TISSUE SPECIFICITY: Expressed in fetal brain, liver, muscle and in adult brain. Also expressed in neuroblastoma and glioblastoma tumors.	alternative mRNA splicing, via spliceosome [GO:0000380]; hemopoiesis [GO:0030097]; multicellular organism development [GO:0007275]; phosphorylation of RNA polymerase II C-terminal domain [GO:0070816]; positive regulation of cell proliferation [GO:0008284]; regulation of mitotic nuclear division [GO:0007088]; viral process [GO:0016032]	NA	NA	11162436; 12853948; 1731328; 11347906; 15144186; 17081983; 16721827; 17525332; 18220336; 18480452; 18691976; 18669648; 19413330; 19369195; 19690332; 19608861; 20952539; 20068231; 21269460; 21835166; 22012619; 21406692; 23186163; 24275569; 17344846
7	72420679	nonsynonymous	G	A	0.371428571428571	1	POM121	TRUE	Q96HA1	reviewed	Nuclear envelope pore membrane protein POM 121 (Nuclear envelope pore membrane protein POM 121A) (Nucleoporin Nup121) (Pore membrane protein of 121 kDa)	POM121 KIAA0618 NUP121 POM121A	5 out of 5	NA	gene silencing by RNA [GO:0031047]; intracellular transport of virus [GO:0075733]; mitotic nuclear envelope disassembly [GO:0007077]; mRNA export from nucleus [GO:0006406]; protein sumoylation [GO:0016925]; protein transport [GO:0015031]; regulation of cellular response to heat [GO:1900034]; regulation of glucose transport [GO:0010827]; tRNA export from nucleus [GO:0006409]; viral process [GO:0016032]; viral transcription [GO:0019083]	NA	NA	9734811; 14702039; 12853948; 15489334; 17900573; 17974005; 18669648; 19413330; 20068231; 21406692; 23186163
7	72420679	nonsynonymous	G	A	0.371428571428571	1	NSUN5P2	TRUE	Q63ZY6	reviewed	Putative methyltransferase NSUN5C (EC 2.1.1.-) (NOL1/NOP2/Sun domain family member 5C) (Williams-Beuren syndrome chromosomal region 20C protein)	NSUN5P2 NSUN5C WBSCR20B WBSCR20C	5 out of 5	TISSUE SPECIFICITY: Ubiquitous. {ECO:0000269|PubMed:11978965, ECO:0000269|PubMed:12073013}.	NA	DISEASE: Note=NSUN5C is located in the Williams-Beuren syndrome (WBS) critical region. WBS results from a hemizygous deletion of several genes on chromosome 7q11.23, thought to arise as a consequence of unequal crossing over between highly homologous low-copy repeat sequences flanking the deleted region.	NA	11978965; 12073013; 14702039; 17974005; 15489334
7	73008233	nonsynonymous	G	A	0.458333333333333	0.2	MLXIPL	TRUE	Q9NP71	reviewed	Carbohydrate-responsive element-binding protein (ChREBP) (Class D basic helix-loop-helix protein 14) (bHLHd14) (MLX interactor) (MLX-interacting protein-like) (WS basic-helix-loop-helix leucine zipper protein) (WS-bHLH) (Williams-Beuren syndrome chromosomal region 14 protein)	MLXIPL BHLHD14 MIO WBSCR14	5 out of 5	TISSUE SPECIFICITY: Expressed in liver, heart, kidney, cerebellum and intestinal tissues.	anatomical structure morphogenesis [GO:0009653]; cellular response to carbohydrate stimulus [GO:0071322]; fatty acid homeostasis [GO:0055089]; glucose homeostasis [GO:0042593]; glucose mediated signaling pathway [GO:0010255]; intracellular signal transduction [GO:0035556]; negative regulation of cell cycle arrest [GO:0071157]; negative regulation of oxidative phosphorylation [GO:0090324]; negative regulation of peptidyl-serine phosphorylation [GO:0033137]; negative regulation of transcription, DNA-templated [GO:0045892]; positive regulation of cell proliferation [GO:0008284]; positive regulation of fatty acid biosynthetic process [GO:0045723]; positive regulation of glycolytic process [GO:0045821]; positive regulation of lipid biosynthetic process [GO:0046889]; positive regulation of transcription, DNA-templated [GO:0045893]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; regulation of energy homeostasis [GO:2000505]; regulation of transcription, DNA-templated [GO:0006355]; regulation of transcription from RNA polymerase II promoter [GO:0006357]; transcription, DNA-templated [GO:0006351]; triglyceride homeostasis [GO:0070328]	DISEASE: Note=WBSCR14 is located in the Williams-Beuren syndrome (WBS) critical region. WBS results from a hemizygous deletion of several genes on chromosome 7q11.23, thought to arise as a consequence of unequal crossing over between highly homologous low-copy repeat sequences flanking the deleted region. Haploinsufficiency of WBSCR14 may be the cause of certain cardiovascular and musculo-skeletal abnormalities observed in the disease. {ECO:0000269|PubMed:10780788}.	NA	10780788; 11230181; 9860302; 15489334; 14759258; 23186163; 24275569
7	87060844	nonsynonymous	C	T	0.538461538461538	1	ABCB4	TRUE	P21439	reviewed	Phosphatidylcholine translocator ABCB4 (ATP-binding cassette sub-family B member 4) (Multidrug resistance protein 3) (EC 3.6.3.44) (P-glycoprotein 3)	ABCB4 MDR3 PGY3	5 out of 5	NA	antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent [GO:0002489]; antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent [GO:0002485]; antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent [GO:0002481]; bile acid secretion [GO:0032782]; cellular response to bile acid [GO:1903413]; lipid homeostasis [GO:0055088]; lipid metabolic process [GO:0006629]; phospholipid translocation [GO:0045332]; positive regulation of antigen processing and presentation of peptide antigen via MHC class I [GO:0002591]; positive regulation of cholesterol transport [GO:0032376]; positive regulation of phospholipid translocation [GO:0061092]; positive regulation of phospholipid transport [GO:2001140]; response to drug [GO:0042493]; response to fenofibrate [GO:1901557]; transmembrane transport [GO:0055085]; transport [GO:0006810]	DISEASE: Cholestasis, progressive familial intrahepatic, 3 (PFIC3) [MIM:602347]: A disorder characterized by early onset of cholestasis that progresses to hepatic fibrosis, cirrhosis, and end-stage liver disease before adulthood. {ECO:0000269|PubMed:11313315, ECO:0000269|PubMed:12671900, ECO:0000269|PubMed:17726488, ECO:0000269|PubMed:21119540, ECO:0000269|PubMed:24045840, ECO:0000269|PubMed:24594635, ECO:0000269|PubMed:24806754, ECO:0000269|PubMed:9419367}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Cholestasis of pregnancy, intrahepatic 3 (ICP3) [MIM:614972]: A liver disorder of pregnancy. It presents during the second or, more commonly, the third trimester of pregnancy with intense pruritus which becomes more severe with advancing gestation and cholestasis. It causes fetal distress, spontaneous premature delivery and intrauterine death. Patients have spontaneous and progressive disappearance of cholestasis after delivery. Cholestasis results from abnormal biliary transport from the liver into the small intestine. {ECO:0000269|PubMed:10767346, ECO:0000269|PubMed:12746424, ECO:0000269|PubMed:15077010}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Gallbladder disease 1 (GBD1) [MIM:600803]: One of the major digestive diseases. Gallstones composed of cholesterol (cholelithiasis) are the common manifestations in western countries. Most people with gallstones, however, remain asymptomatic through their lifetimes. {ECO:0000269|PubMed:11313316, ECO:0000269|PubMed:12891548, ECO:0000269|PubMed:22331132, ECO:0000269|PubMed:23533021, ECO:0000269|PubMed:24723470, ECO:0000269|Ref.2}. Note=The disease is caused by mutations affecting the gene represented in this entry.	69665;69663;79305;	2906314; 12853948; 12690205; 7893760; 2892668; 2002063; 7957936; 8898203; 9366571; 9419367; 15258199; 17523162; 19674157; 21820390; 23468132; 24122873; 24806754; 10767346; 11313315; 11313316; 12671900; 12891548; 12746424; 15077010; 16763017; 17726488; 17264802; 19261551; 21119540; 22331132; 23533021; 24045840; 24723470; 24594635
7	91694743	nonsynonymous	A	G	0.441176470588235	1	AKAP9	TRUE	Q99996	reviewed	A-kinase anchor protein 9 (AKAP-9) (A-kinase anchor protein 350 kDa) (AKAP 350) (hgAKAP 350) (A-kinase anchor protein 450 kDa) (AKAP 450) (AKAP 120-like protein) (Centrosome- and Golgi-localized PKN-associated protein) (CG-NAP) (Protein hyperion) (Protein kinase A-anchoring protein 9) (PRKA9) (Protein yotiao)	AKAP9 AKAP350 AKAP450 KIAA0803	5 out of 5	TISSUE SPECIFICITY: Widely expressed (PubMed:10202149). Isoform 4: Highly expressed in skeletal muscle and in pancreas (PubMed:9482789). {ECO:0000269|PubMed:10202149, ECO:0000269|PubMed:9482789}.	cardiac conduction [GO:0061337]; cellular response to cAMP [GO:0071320]; G2/M transition of mitotic cell cycle [GO:0000086]; MAPK cascade [GO:0000165]; microtubule nucleation [GO:0007020]; positive regulation of peptidyl-serine phosphorylation [GO:0033138]; positive regulation of potassium ion transmembrane transporter activity [GO:1901018]; regulation of heart rate by cardiac conduction [GO:0086091]; regulation of membrane repolarization [GO:0060306]; regulation of ventricular cardiac muscle cell membrane repolarization [GO:0060307]; signal transduction [GO:0007165]; synaptic transmission [GO:0007268]; transport [GO:0006810]	DISEASE: Long QT syndrome 11 (LQT11) [MIM:611820]: A heart disorder characterized by a prolonged QT interval on the ECG and polymorphic ventricular arrhythmias. They cause syncope and sudden death in response to exercise or emotional stress, and can present with a sentinel event of sudden cardiac death in infancy. {ECO:0000269|PubMed:18093912}. Note=The disease is caused by mutations affecting the gene represented in this entry.	101016;	9482789; 10202149; 10358086; 12853948; 12690205; 9915845; 9872452; 12163479; 12270714; 11799244; 15047863; 17525332; 19242490; 19690332; 21269460; 23186163; 24275569; 16959974; 18093912
7	127953238	nonsynonymous	G	A	0.64	0.3	RBM28	TRUE	Q9NW13	reviewed	RNA-binding protein 28 (RNA-binding motif protein 28)	RBM28	5 out of 5	TISSUE SPECIFICITY: Ubiquitously expressed. {ECO:0000269|PubMed:18439547}.	mRNA processing [GO:0006397]; RNA splicing [GO:0008380]	DISEASE: Alopecia, neurologic defects, and endocrinopathy syndrome (ANES) [MIM:612079]: Affected individuals have hair loss of variable severity, ranging from complete alopecia to near-normal scalp hair with absence of body hair. All have moderate to severe mental retardation, progressive motor deterioration and central hypogonadotropic hypogonadism with delayed or absent puberty and central adrenal insufficiency. Additional features included short stature, microcephaly, gynecomastia, pigmentary anomalies, hypodontia, kyphoscoliosis, ulnar deviation of the hands, and loss of subcutaneous fat. {ECO:0000269|PubMed:18439547}. Note=The disease is caused by mutations affecting the gene represented in this entry.	157954;	14702039; 12853948; 12690205; 15489334; 17081119; 12429849; 18669648; 21269460; 22814378; 23186163; 18439547
7	129100173	nonsynonymous	T	G	0.454545454545455	1	STRIP2	TRUE	Q9ULQ0	reviewed	Striatin-interacting protein 2 (Protein FAM40B)	STRIP2 FAM40B KIAA1170	5 out of 5	NA	cell migration [GO:0016477]; cytoskeleton organization [GO:0007010]; regulation of cell shape [GO:0008360]	NA	NA	10574461; 12853948; 15489334; 18782753; 21834987; 23186163
7	131195917	nonsynonymous	T	G	0.421052631578947	0	PODXL	TRUE	O00592	reviewed	Podocalyxin (GCTM-2 antigen) (Gp200) (Podocalyxin-like protein 1) (PC) (PCLP-1)	PODXL PCLP PCLP1	5 out of 5	TISSUE SPECIFICITY: Glomerular epithelium cell (podocyte).	cell adhesion [GO:0007155]; cell migration [GO:0016477]; epithelial tube formation [GO:0072175]; glomerular visceral epithelial cell development [GO:0072015]; leukocyte migration [GO:0050900]; negative regulation of cell adhesion [GO:0007162]; negative regulation of cell-cell adhesion [GO:0022408]; positive regulation of cell-cell adhesion mediated by integrin [GO:0033634]; positive regulation of cell migration [GO:0030335]; regulation of microvillus assembly [GO:0032534]	NA	NA	9188463; 12853948; 12690205; 15489334; 12504081; 17616675; 18456258; 18669648; 20068231; 21269460; 21406692; 25944712
7	135242703	nonsynonymous	C	T	0.5	1	NUP205	TRUE	Q92621	reviewed	Nuclear pore complex protein Nup205 (205 kDa nucleoporin) (Nucleoporin Nup205)	NUP205 C7orf14 KIAA0225	5 out of 5	NA	gene silencing by RNA [GO:0031047]; intracellular transport of virus [GO:0075733]; mitotic nuclear envelope disassembly [GO:0007077]; mRNA export from nucleus [GO:0006406]; nuclear pore complex assembly [GO:0051292]; nucleocytoplasmic transport [GO:0006913]; protein import into nucleus, docking [GO:0000059]; protein sumoylation [GO:0016925]; regulation of cellular response to heat [GO:1900034]; regulation of glucose transport [GO:0010827]; tRNA export from nucleus [GO:0006409]; viral process [GO:0016032]; viral transcription [GO:0019083]	NA	NA	9039502; 12853948; 15489334; 9348540; 12802065; 15229283; 15703211; 18691976; 19413330; 19690332; 20068231; 21269460; 22223895; 23186163; 24275569
7	142008644	nonsynonymous	CA	TC	0.428571428571429	0	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
7	142119928	nonsynonymous	G	A	0.275862068965517	0	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
7	142139296	nonsynonymous	C	A	0.333333333333333	0.3	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
7	142458737	nonsynonymous	CCT	GCC	0.275862068965517	0	PRSS1	FALSE	P07477	reviewed	Trypsin-1 (EC 3.4.21.4) (Beta-trypsin) (Cationic trypsinogen) (Serine protease 1) (Trypsin I) [Cleaved into: Alpha-trypsin chain 1; Alpha-trypsin chain 2]	PRSS1 TRP1 TRY1 TRYP1	5 out of 5	NA	cobalamin metabolic process [GO:0009235]; digestion [GO:0007586]; extracellular matrix disassembly [GO:0022617]	DISEASE: Pancreatitis, hereditary (PCTT) [MIM:167800]: A disease characterized by pancreas inflammation, permanent destruction of the pancreatic parenchyma, maldigestion, and severe abdominal pain attacks. {ECO:0000269|PubMed:10204851, ECO:0000269|PubMed:10381903, ECO:0000269|PubMed:10930381, ECO:0000269|PubMed:11073545, ECO:0000269|PubMed:11788572, ECO:0000269|PubMed:11866271, ECO:0000269|PubMed:14695529, ECO:0000269|PubMed:15776435, ECO:0000269|PubMed:8841182, ECO:0000269|PubMed:9322498, ECO:0000269|PubMed:9633818}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.	676;	3011602; 8650574; 14702039; 12853948; 12690205; 15489334; 10930381; 7945238; 2598466; 8841182; 11866271; 17087724; 25010489; 8683601; 9322498; 9633818; 10381903; 10204851; 11073545; 11788572; 14695529; 15776435; 16959974
7	155301717	nonsynonymous	G	C	0.5	1	CNPY1	TRUE	Q3B7I2	reviewed	Protein canopy homolog 1	CNPY1	2 out of 5	NA	enzyme linked receptor protein signaling pathway [GO:0007167]; tissue development [GO:0009888]	NA	NA	12853948; 12690205; 15489334
7	158727230	nonsynonymous	C	A	0.444444444444444	1	WDR60	TRUE	Q8WVS4	reviewed	WD repeat-containing protein 60	WDR60	4 out of 5	TISSUE SPECIFICITY: Expressed in chondrocytes (at protein level). {ECO:0000269|PubMed:23910462}.	cell projection organization [GO:0030030]	DISEASE: Short-rib thoracic dysplasia 8 with or without polydactyly (SRTD8) [MIM:615503]: A form of short-rib thoracic dysplasia, a group of autosomal recessive ciliopathies that are characterized by a constricted thoracic cage, short ribs, shortened tubular bones, and a 'trident' appearance of the acetabular roof. Polydactyly is variably present. Non-skeletal involvement can include cleft lip/palate as well as anomalies of major organs such as the brain, eye, heart, kidneys, liver, pancreas, intestines, and genitalia. Some forms of the disease are lethal in the neonatal period due to respiratory insufficiency secondary to a severely restricted thoracic cage, whereas others are compatible with life. Disease spectrum encompasses Ellis-van Creveld syndrome, asphyxiating thoracic dystrophy (Jeune syndrome), Mainzer-Saldino syndrome, and short rib-polydactyly syndrome. {ECO:0000269|PubMed:23910462}. Note=The disease is caused by mutations affecting the gene represented in this entry. Fibroblasts from affected individuals exhibit a defect in ciliogenesis and aberrant accumulation of the GLI2 transcription factor at the centrosome or basal body in the absence of an obvious axoneme.	474;93271;	12853948; 15489334; 14702039; 18669648; 23186163; 23910462
8	3072048	nonsynonymous	G	A	0.428571428571429	1	CSMD1	TRUE	Q96PZ7	reviewed	CUB and sushi domain-containing protein 1 (CUB and sushi multiple domains protein 1)	CSMD1 KIAA1890 UNQ5952/PRO19863	4 out of 5	TISSUE SPECIFICITY: Weakly expressed in most tissues, except in brain. Expressed at intermediate level in brain, including cerebellum, substantia nigra, hippocampus and fetal brain. {ECO:0000269|PubMed:11572484}.	NA	NA	NA	11472063; 16751668; 12975309; 11572484; 14702039; 12696061; 14506705; 
8	16026115	nonsynonymous	G	T	0.382352941176471	0.4	MSR1	TRUE	P21757	reviewed	Macrophage scavenger receptor types I and II (Macrophage acetylated LDL receptor I and II) (Scavenger receptor class A member 1) (CD antigen CD204)	MSR1 SCARA1	5 out of 5	TISSUE SPECIFICITY: Isoform I, isoform II and isoform III are expressed in monocyte-derived macrophages. {ECO:0000269|PubMed:9548586}.	cellular response to organic cyclic compound [GO:0071407]; cholesterol transport [GO:0030301]; lipoprotein transport [GO:0042953]; plasma lipoprotein particle clearance [GO:0034381]; positive regulation of cholesterol storage [GO:0010886]; positive regulation of macrophage derived foam cell differentiation [GO:0010744]; receptor-mediated endocytosis [GO:0006898]	DISEASE: Prostate cancer (PC) [MIM:176807]: A malignancy originating in tissues of the prostate. Most prostate cancers are adenocarcinomas that develop in the acini of the prostatic ducts. Other rare histopathologic types of prostate cancer that occur in approximately 5% of patients include small cell carcinoma, mucinous carcinoma, prostatic ductal carcinoma, transitional cell carcinoma, squamous cell carcinoma, basal cell carcinoma, adenoid cystic carcinoma (basaloid), signet-ring cell carcinoma and neuroendocrine carcinoma. {ECO:0000269|PubMed:12244320}. Note=The disease may be caused by mutations affecting the gene represented in this entry. MSR1 variants may play a role in susceptibility to prostate cancer. MSR1 variants have been found in individuals with prostate cancer and co-segregate with the disease in some families.; DISEASE: Barrett esophagus (BE) [MIM:614266]: A condition characterized by a metaplastic change in which normal esophageal squamous epithelium is replaced by a columnar and intestinal-type epithelium. Patients with Barrett esophagus have an increased risk of esophageal adenocarcinoma. The main cause of Barrett esophagus is gastroesophageal reflux. The retrograde movement of acid and bile salts from the stomach into the esophagus causes prolonged injury to the esophageal epithelium and induces chronic esophagitis, which in turn is believed to trigger the pathologic changes. {ECO:0000269|PubMed:21791690}. Note=The disease may be caused by mutations affecting the gene represented in this entry. Genetic variants in MSR1 have been found in individuals with Barrett esophagus and are thought to contribute to disease susceptibility.	1232;1331;	2251254; 9548586; 16421571; 15489334; 8093617; 8900177; 12244320; 14759258; 19159218; 21791690
8	18729328	nonsynonymous	C	A	0.5	0	PSD3	TRUE	Q9NYI0	reviewed	PH and SEC7 domain-containing protein 3 (Epididymis tissue protein Li 20mP) (Exchange factor for ADP-ribosylation factor guanine nucleotide factor 6) (Hepatocellular carcinoma-associated antigen 67) (Pleckstrin homology and SEC7 domain-containing protein 3)	PSD3 EFA6R HCA67 KIAA0942	4 out of 5	TISSUE SPECIFICITY: Isoform 2 is expressed in epididymis (at protein level). {ECO:0000269|PubMed:20736409}.	regulation of ARF protein signal transduction [GO:0032012]	NA	NA	10231032; 12168954; 20736409; 16421571; 12097419; 15489334; 18669648; 24275569
8	59409493	nonsynonymous	G	A	0.458333333333333	0.5	CYP7A1	TRUE	P22680	reviewed	Cholesterol 7-alpha-monooxygenase (EC 1.14.14.23) (CYPVII) (Cholesterol 7-alpha-hydroxylase) (Cytochrome P450 7A1)	CYP7A1 CYP7	5 out of 5	TISSUE SPECIFICITY: Detected in liver. {ECO:0000269|PubMed:15796896}.	bile acid biosynthetic process [GO:0006699]; cellular response to cholesterol [GO:0071397]; cellular response to glucose stimulus [GO:0071333]; cholesterol catabolic process [GO:0006707]; cholesterol homeostasis [GO:0042632]; regulation of bile acid biosynthetic process [GO:0070857]; sterol metabolic process [GO:0016125]	NA	209902;	8439551; 2384150; 1610352; 15489334; 8020987; 1312351; 15796896; 19965590; 12721789
8	68334782	nonsynonymous	G	A	0.25	1	LOC102724708	FALSE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
8	68334782	nonsynonymous	G	A	0.25	1	CPA6	TRUE	Q8N4T0	reviewed	Carboxypeptidase A6 (EC 3.4.17.-)	CPA6 CPAH	5 out of 5	TISSUE SPECIFICITY: Expressed in the hippocampus, nucleus raphe, and cortex. {ECO:0000269|PubMed:21922598}.	NA	DISEASE: Note=A chromosomal aberration involving CPA6 was found in a patient with Duane retraction syndrome. Translocation t(6;8)(q26;q13).; DISEASE: Epilepsy, familial temporal lobe, 5 (ETL5) [MIM:614417]: A focal form of epilepsy characterized by recurrent seizures that arise from foci within the temporal lobe. Seizures are usually accompanied by sensory symptoms, most often auditory in nature. {ECO:0000269|PubMed:21922598}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Febrile seizures, familial, 11 (FEB11) [MIM:614418]: Seizures associated with febrile episodes in childhood without any evidence of intracranial infection or defined pathologic or traumatic cause. It is a common condition, affecting 2-5% of children aged 3 months to 5 years. The majority are simple febrile seizures (generally defined as generalized onset, single seizures with a duration of less than 30 minutes). Complex febrile seizures are characterized by focal onset, duration greater than 30 minutes, and/or more than one seizure in a 24 hour period. The likelihood of developing epilepsy following simple febrile seizures is low. Complex febrile seizures are associated with a moderately increased incidence of epilepsy. {ECO:0000269|PubMed:21922598}. Note=The disease is caused by mutations affecting the gene represented in this entry.	165805;	11836249; 12454025; 15489334; 18178555; 20855895; 21922598
8	126091044	nonsynonymous	G	A	0.481481481481481	1	KIAA0196	TRUE	Q12768	reviewed	WASH complex subunit strumpellin (Strumpellin)	KIAA0196	5 out of 5	TISSUE SPECIFICITY: Expressed ubiquitously. {ECO:0000269|PubMed:20833645}.	endosomal transport [GO:0016197]; oocyte maturation [GO:0001556]; polar body extrusion after meiotic divisions [GO:0040038]; protein transport [GO:0015031]; spindle assembly involved in meiosis [GO:0090306]	DISEASE: Spastic paraplegia 8, autosomal dominant (SPG8) [MIM:603563]: A form of spastic paraplegia, a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. {ECO:0000269|PubMed:17160902, ECO:0000269|PubMed:23455931, ECO:0000269|PubMed:23881105}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Ritscher-Schinzel syndrome 1 (RTSC1) [MIM:220210]: A developmental malformation syndrome characterized by craniofacial abnormalities, congenital heart defects, and cerebellar brain malformations. Facial features include prominent occiput, prominent forehead, low-set ears, downslanting palpebral fissures, depressed nasal bridge, and micrognathia. Cardiac defects can include septal defects and aortic stenosis, among others, and brain imaging shows Dandy-Walker malformation, cerebellar vermis hypoplasia, posterior fossa cysts, and ventricular dilatation. Affected individuals have severe developmental delay. {ECO:0000269|PubMed:24065355}. Note=The disease is caused by mutations affecting the gene represented in this entry.	7;100989;	8724849; 14702039; 15489334; 18691976; 19922875; 20833645; 20498093; 21269460; 23085491; 24065355; 23186163; 23676666; 25944712; 17160902; 23881105; 23455931; 25454649
8	143763919	nonsynonymous	C	A	0.52	0	PSCA	TRUE	O43653	reviewed	Prostate stem cell antigen	PSCA UNQ206/PRO232	5 out of 5	TISSUE SPECIFICITY: Highly expressed in prostate (basal, secretory and neuroendocrine epithelium cells). Also found in bladder (transitional epithelium), placenta (trophoblasts), stomach (neuroendocrine cells), colon (neuroendocrine cells) and kidney (collecting ducts). Overexpressed in prostate cancers and expression is correlated with tumor stage, grade and androgen-independence. Highly expressed in prostate cancer bone metastases. Expressed in gastric epithelial cells, mainly in the isthmus (at protein level). Not detected in normal intestinal epithelium (at protein level). {ECO:0000269|PubMed:10713670, ECO:0000269|PubMed:18488030}.	NA	NA	NA	9465086; 10973799; 16421571; 15489334; 12975309; 15340161; 10713670; 18488030
8	145580028	nonsynonymous	A	G	0.434782608695652	1	FBXL6	TRUE	Q8N531	reviewed	F-box/LRR-repeat protein 6 (F-box and leucine-rich repeat protein 6) (F-box protein FBL6) (FBL6A)	FBXL6 FBL6	3 out of 5	NA	proteolysis [GO:0006508]	NA	NA	14702039; 15489334; 10531035
9	4117933	nonsynonymous	C	G	0.625	1	GLIS3	TRUE	Q8NEA6	reviewed	Zinc finger protein GLIS3 (GLI-similar 3) (Zinc finger protein 515)	GLIS3 ZNF515	4 out of 5	TISSUE SPECIFICITY: In the adult, expressed at high levels in the kidney and at lower levels in the brain, skeletal muscle, pancreas, liver, lung, thymus and ovary. {ECO:0000269|PubMed:14500813}.	negative regulation of transcription from RNA polymerase II promoter [GO:0000122]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; transcription from RNA polymerase II promoter [GO:0006366]	DISEASE: Diabetes mellitus, neonatal, with congenital hypothyroidism (NDH) [MIM:610199]: A syndrome of neonatal diabetes syndrome associated with congenital hypothyroidism, congenital glaucoma, hepatic fibrosis and polycystic kidneys. {ECO:0000269|PubMed:16715098, ECO:0000269|PubMed:21139041}. Note=The disease is caused by mutations affecting the gene represented in this entry.	79118;	15164053; 15489334; 16715098; 14500813; 21139041
9	4663252	nonsynonymous	A	C	0.653846153846154	1	SPATA6L	FALSE	Q8N4H0	reviewed	Spermatogenesis associated 6-like protein	SPATA6L C9orf68	2 out of 5	NA	NA	NA	NA	14702039; 15164053; 15489334
9	4663252	nonsynonymous	A	C	0.653846153846154	1	PLPP6	TRUE	Q8IY26	reviewed	Phospholipid phosphatase 6 (EC 3.1.3.-) (Phosphatidic acid phosphatase type 2 domain-containing protein 2) (PPAP2 domain-containing protein 2) (Presqualene diphosphate phosphatase)	PLPP6 PPAPDC2	3 out of 5	TISSUE SPECIFICITY: Widely expressed. Expressed in most organs, in particular gastrointestinal organs, spleen, placenta, kidney, thymus and brain. {ECO:0000269|PubMed:16464866}.	NA	NA	NA	14702039; 15164053; 15489334; 16464866; 21269460; 24275569
9	5921881	nonsynonymous	G	A	0.515151515151515	0.1	KIAA2026	TRUE	Q5HYC2	reviewed	Uncharacterized protein KIAA2026	KIAA2026	2 out of 5	NA	NA	NA	NA	15164053; 17974005; 15489334; 
9	14116327	nonsynonymous	C	G	0.48	1	NFIB	TRUE	O00712	reviewed	Nuclear factor 1 B-type (NF1-B) (Nuclear factor 1/B) (CCAAT-box-binding transcription factor) (CTF) (Nuclear factor I/B) (NF-I/B) (NFI-B) (TGGCA-binding protein)	NFIB	5 out of 5	NA	anterior commissure morphogenesis [GO:0021960]; cell differentiation involved in salivary gland development [GO:0060689]; chondrocyte differentiation [GO:0002062]; Clara cell differentiation [GO:0060486]; commissural neuron axon guidance [GO:0071679]; DNA replication [GO:0006260]; glial cell differentiation [GO:0010001]; hindbrain development [GO:0030902]; lung ciliated cell differentiation [GO:0061141]; negative regulation of DNA binding [GO:0043392]; negative regulation of epithelial cell proliferation involved in lung morphogenesis [GO:2000795]; negative regulation of mesenchymal cell proliferation involved in lung development [GO:2000791]; negative regulation of pri-miRNA transcription from RNA polymerase II promoter [GO:1902894]; negative regulation of transcription from RNA polymerase II promoter [GO:0000122]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; principal sensory nucleus of trigeminal nerve development [GO:0021740]; salivary gland cavitation [GO:0060662]; Type II pneumocyte differentiation [GO:0060510]; Type I pneumocyte differentiation [GO:0060509]	NA	NA	9484777; 9099724; 14702039; 17974005; 15164053; 15489334; 7590749; 18669648; 20068231; 23186163; 24275569
9	32500832	nonsynonymous	C	T	0.44	1	DDX58	TRUE	O95786	reviewed	Probable ATP-dependent RNA helicase DDX58 (EC 3.6.4.13) (DEAD box protein 58) (RIG-I-like receptor 1) (RLR-1) (Retinoic acid-inducible gene 1 protein) (RIG-1) (Retinoic acid-inducible gene I protein) (RIG-I)	DDX58	5 out of 5	TISSUE SPECIFICITY: Present in vascular smooth cells (at protein level). {ECO:0000269|PubMed:15219805}.	cytoplasmic pattern recognition receptor signaling pathway in response to virus [GO:0039528]; detection of virus [GO:0009597]; innate immune response [GO:0045087]; negative regulation of type I interferon production [GO:0032480]; positive regulation of defense response to virus by host [GO:0002230]; positive regulation of gene expression [GO:0010628]; positive regulation of granulocyte macrophage colony-stimulating factor production [GO:0032725]; positive regulation of interferon-alpha production [GO:0032727]; positive regulation of interferon-beta production [GO:0032728]; positive regulation of interleukin-6 production [GO:0032755]; positive regulation of interleukin-8 production [GO:0032757]; positive regulation of sequence-specific DNA binding transcription factor activity [GO:0051091]; positive regulation of transcription factor import into nucleus [GO:0042993]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; regulation of cell migration [GO:0030334]; regulation of type III interferon production [GO:0034344]; response to exogenous dsRNA [GO:0043330]; response to virus [GO:0009615]; RIG-I signaling pathway [GO:0039529]; viral process [GO:0016032]	DISEASE: Singleton-Merten syndrome 2 (SGMRT2) [MIM:616298]: A form of Singleton-Merten syndrome, an autosomal dominant disorder characterized by marked aortic calcification, dental anomalies, osteopenia, acro-osteolysis, and to a lesser extend glaucoma, psoriasis, muscle weakness, and joint laxity. Additional clinical manifestations include particular facial characteristics and abnormal joint and muscle ligaments. SGMRT2 is an atypical form characterized by variable expression of glaucoma, aortic calcification, and skeletal abnormalities, without dental anomalies. {ECO:0000269|PubMed:25620203}. Note=The disease is caused by mutations affecting the gene represented in this entry.	NA	11890704; 15164053; 15489334; 17974005; 15181474; 15219805; 15208624; 16125763; 16281057; 15708988; 16153868; 16127453; 16009940; 17392790; 17190814; 18636086; 18057259; 18724357; 19631370; 19576794; 19017631; 19122199; 19211564; 19419966; 19193793; 19609254; 19484123; 19608861; 20434986; 20368735; 21175414; 20007272; 21269460; 21616437; 21884169; 21742966; 21813773; 20950133; 21068236; 21791617; 21102435; 22152002; 22301138; 23399697; 23843640; 24755855; 25620203; 18243112; 18242112; 25018021
9	33796744	nonsynonymous	CGG	TGT	0.266666666666667	0.9	PRSS3	TRUE	P35030	reviewed	Trypsin-3 (EC 3.4.21.4) (Brain trypsinogen) (Mesotrypsinogen) (Serine protease 3) (Serine protease 4) (Trypsin III) (Trypsin IV)	PRSS3 PRSS4 TRY3 TRY4	5 out of 5	TISSUE SPECIFICITY: Expressed in pancreas and brain. Also expressed in Paneth cells, at the base of small intestinal crypts. {ECO:0000269|PubMed:12021776}.	cobalamin metabolic process [GO:0009235]; digestion [GO:0007586]; endothelial cell migration [GO:0043542]; proteolysis [GO:0006508]; zymogen activation [GO:0031638]	NA	NA	8294000; 2326201; 19924134; 15164053; 15489334; 12021776; 14507909; 11827488
9	33797828	nonsynonymous	C	T	0.239130434782609	0.9	PRSS3	TRUE	P35030	reviewed	Trypsin-3 (EC 3.4.21.4) (Brain trypsinogen) (Mesotrypsinogen) (Serine protease 3) (Serine protease 4) (Trypsin III) (Trypsin IV)	PRSS3 PRSS4 TRY3 TRY4	5 out of 5	TISSUE SPECIFICITY: Expressed in pancreas and brain. Also expressed in Paneth cells, at the base of small intestinal crypts. {ECO:0000269|PubMed:12021776}.	cobalamin metabolic process [GO:0009235]; digestion [GO:0007586]; endothelial cell migration [GO:0043542]; proteolysis [GO:0006508]; zymogen activation [GO:0031638]	NA	NA	8294000; 2326201; 19924134; 15164053; 15489334; 12021776; 14507909; 11827488
9	35555458	nonsynonymous	G	A	0.6	1	RUSC2	TRUE	Q8N2Y8	reviewed	Iporin (Interacting protein of Rab1) (RUN and SH3 domain-containing protein 2)	RUSC2 KIAA0375	4 out of 5	TISSUE SPECIFICITY: Widely expressed, with highest levels in brain and testis. {ECO:0000269|PubMed:15796781}.	NA	NA	NA	9205841; 15164053; 15489334; 15796781; 17081983; 18220336; 18669648; 23186163
9	78973431	nonsynonymous	G	A	0.608695652173913	1	PCSK5	TRUE	Q92824	reviewed	Proprotein convertase subtilisin/kexin type 5 (EC 3.4.21.-) (Proprotein convertase 5) (PC5) (Proprotein convertase 6) (PC6) (hPC6) (Subtilisin/kexin-like protease PC5)	PCSK5 PC5 PC6	5 out of 5	TISSUE SPECIFICITY: Expressed in T-lymphocytes.	anterior/posterior pattern specification [GO:0009952]; cardiac septum development [GO:0003279]; cell-cell signaling [GO:0007267]; coronary vasculature development [GO:0060976]; cytokine biosynthetic process [GO:0042089]; determination of left/right symmetry [GO:0007368]; embryo implantation [GO:0007566]; embryonic digestive tract development [GO:0048566]; embryonic skeletal system development [GO:0048706]; heart development [GO:0007507]; kidney development [GO:0001822]; limb morphogenesis [GO:0035108]; nerve growth factor processing [GO:0032455]; peptide biosynthetic process [GO:0043043]; peptide hormone processing [GO:0016486]; protein processing [GO:0016485]; renin secretion into blood stream [GO:0002001]; respiratory tube development [GO:0030323]; signal peptide processing [GO:0006465]; viral life cycle [GO:0019058]	NA	NA	8755538; 17974005; 15164053; 15489334; 14702039; 19764806; 20555025; 22740495
9	79930342	nonsynonymous	C	G	0.5	0	VPS13A	TRUE	Q96RL7	reviewed	Vacuolar protein sorting-associated protein 13A (Chorea-acanthocytosis protein) (Chorein)	VPS13A CHAC KIAA0986	5 out of 5	TISSUE SPECIFICITY: Widely expressed. Higher expression is found in brain, heart, skeletal muscle and kidney.	autophagy [GO:0006914]; Golgi to endosome transport [GO:0006895]; locomotory behavior [GO:0007626]; nervous system development [GO:0007399]; protein localization [GO:0008104]; protein retention in Golgi apparatus [GO:0045053]; protein targeting to vacuole [GO:0006623]; social behavior [GO:0035176]	DISEASE: Choreoacanthocytosis (CHAC) [MIM:200150]: An autosomal recessive neurodegenerative disorder characterized by the gradual onset of hyperkinetic movements and abnormal erythrocyte morphology. Basal ganglia atrophy in the brain is a pathological feature of the disease. Other clinical symptoms include psychiatric features, epilepsy, peripheral neuropathy, myopathy and oral self-mutilation. {ECO:0000269|PubMed:11381253, ECO:0000269|PubMed:12404112}. Note=The disease is caused by mutations affecting the gene represented in this entry.	2388;	11381253; 11381254; 15498460; 15164053; 10231032; 15489334; 14702039; 18669648; 23186163; 24275569; 12404112; 16959974
9	80863212	nonsynonymous	T	C	0.580645161290323	0.6	CEP78	TRUE	Q5JTW2	reviewed	Centrosomal protein of 78 kDa (Cep78)	CEP78 C9orf81	3 out of 5	NA	G2/M transition of mitotic cell cycle [GO:0000086]	NA	NA	15164053; 15489334; 14702039; 14654843; 19413330; 22814378; 23186163
9	84529319	nonsense	C	T	0.454545454545455	0	SPATA31D5P	TRUE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
9	84609162	nonsynonymous	G	C	0.46875	0	SPATA31D1	TRUE	Q6ZQQ2	reviewed	Spermatogenesis-associated protein 31D1 (Protein FAM75D1)	SPATA31D1 FAM75D1	2 out of 5	NA	cell differentiation [GO:0030154]; spermatogenesis [GO:0007283]	NA	NA	14702039; 
9	97321404	nonsynonymous	A	G	0.625	1	PCAT7	TRUE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
9	97321404	nonsynonymous	A	G	0.625	1	FBP2	TRUE	O00757	reviewed	Fructose-1,6-bisphosphatase isozyme 2 (FBPase 2) (EC 3.1.3.11) (D-fructose-1,6-bisphosphate 1-phosphohydrolase 2) (Muscle FBPase)	FBP2	5 out of 5	TISSUE SPECIFICITY: Expressed in skeletal muscle (at protein level). {ECO:0000269|PubMed:12507293}.	fructose metabolic process [GO:0006000]; gluconeogenesis [GO:0006094]	NA	NA	9678974; 15164053; 15489334; 12507293; 16213487; 17350621; 18214967; 19626708; 22120740; 24086250
9	112918755	nonsynonymous	G	A	0.266666666666667	1	PALM2-AKAP2	TRUE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
9	112918755	nonsynonymous	G	A	0.266666666666667	1	AKAP2	TRUE	Q9Y2D5	reviewed	A-kinase anchor protein 2 (AKAP-2) (AKAP-KL) (Protein kinase A-anchoring protein 2) (PRKA2)	AKAP2 KIAA0920 PRKA2	3 out of 5	NA	NA	NA	NA	10231032; 14702039; 15164053; 15489334; 17974005; 11478809; 17081983; 18220336; 18669648; 19413330; 19690332; 20068231; 21406692; 24275569; 25114211; 25944712
9	123932039	nonsynonymous	C	A	0.392857142857143	0	CNTRL	TRUE	Q7Z7A1	reviewed	Centriolin (Centrosomal protein 1) (Centrosomal protein of 110 kDa) (Cep110)	CNTRL CEP1 CEP110	5 out of 5	TISSUE SPECIFICITY: Highly expressed in testis and trachea. {ECO:0000269|PubMed:10688839}.	cell division [GO:0051301]; G2/M transition of mitotic cell cycle [GO:0000086]	DISEASE: Note=A chromosomal aberration involving CEP110 may be a cause of stem cell myeloproliferative disorder (MPD). Translocation t(8;9)(p12;q33) with FGFR1. MPD is characterized by myeloid hyperplasia, eosinophilia and T-cell or B-cell lymphoblastic lymphoma. In general it progresses to acute myeloid leukemia. The fusion protein CEP110-FGFR1 is found in the cytoplasm, exhibits constitutive kinase activity and may be responsible for the transforming activity.	NA	10688839; 12732615; 17974005; 15164053; 15489334; 16112646; 12693554; 11956314; 16213214; 17140400; 23186163
9	125239501	nonsense	G	T	0.5	0	OR1J1	TRUE	Q8NGS3	reviewed	Olfactory receptor 1J1 (Olfactory receptor OR9-18)	OR1J1	3 out of 5	NA	G-protein coupled receptor signaling pathway [GO:0007186]	NA	NA	15164053; 15489334; 12213199; 14983052
9	131021322	nonsynonymous	G	A	0.391304347826087	1	GOLGA2	TRUE	Q08379	reviewed	Golgin subfamily A member 2 (130 kDa cis-Golgi matrix protein) (GM130) (GM130 autoantigen) (Golgin-95)	GOLGA2	5 out of 5	NA	asymmetric cell division [GO:0008356]; centrosome organization [GO:0051297]; COPII vesicle coating [GO:0048208]; ER to Golgi vesicle-mediated transport [GO:0006888]; Golgi disassembly [GO:0090166]; Golgi ribbon formation [GO:0090161]; microtubule nucleation [GO:0007020]; mitotic spindle assembly [GO:0090307]; negative regulation of autophagy [GO:0010507]; negative regulation of protein binding [GO:0032091]; positive regulation of protein glycosylation [GO:0060050]; protein glycosylation [GO:0006486]; protein homotetramerization [GO:0051289]; spindle assembly [GO:0051225]; spindle assembly involved in meiosis [GO:0090306]	NA	NA	8315394; 15164053; 15489334; 11306556; 11781572; 15003503; 16964243; 16489344; 17314401; 18323775; 18045989; 18691976; 18669648; 19242490; 19109421; 20421892; 20068231; 21269460; 23186163; 24275569; 26165940; 25944712
9	131295875	nonsynonymous	G	A	0.516129032258065	1	MIR1268A	FALSE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
9	131295875	nonsynonymous	G	A	0.516129032258065	1	GLE1	TRUE	Q53GS7	reviewed	Nucleoporin GLE1 (hGLE1) (GLE1-like protein)	GLE1 GLE1L	5 out of 5	NA	mRNA export from nucleus [GO:0006406]; poly(A)+ mRNA export from nucleus [GO:0016973]; protein transport [GO:0015031]; regulation of translational initiation [GO:0006446]; regulation of translational termination [GO:0006449]	DISEASE: Lethal congenital contracture syndrome 1 (LCCS1) [MIM:253310]: A form of lethal congenital contracture syndrome, an autosomal recessive disorder characterized by degeneration of anterior horn neurons, extreme skeletal muscle atrophy, and congenital non-progressive joint contractures (arthrogryposis). The contractures can involve the upper or lower limbs and/or the vertebral column, leading to various degrees of flexion or extension limitations evident at birth. LCCS1 patients manifest early fetal hydrops and akinesia, micrognathia, pulmonary hypoplasia, pterygia, and multiple joint contractures. It leads to prenatal death. {ECO:0000269|PubMed:18204449}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Lethal arthrogryposis with anterior horn cell disease (LAAHD) [MIM:611890]: A disorder characterized by fetal akinesia, arthrogryposis and motor neuron loss. The fetus often survives delivery, but dies early as a result of respiratory failure. Neuropathological findings resemble those of lethal congenital contracture syndrome type 1, but are less severe. {ECO:0000269|PubMed:18204449}. Note=The disease is caused by mutations affecting the gene represented in this entry.	53696;1486;	9618489; 15164053; 15489334; 17974005; 12668658; 14645504; 16000379; 19690332; 20068231; 23186163; 18204449
9	138678160	nonsynonymous	C	T	0.466666666666667	1	KCNT1	TRUE	Q5JUK3	reviewed	Potassium channel subfamily T member 1 (KCa4.1)	KCNT1 KIAA1422	5 out of 5	TISSUE SPECIFICITY: Highest expression in liver, brain and spinal cord. Lowest expression in skeletal muscle. {ECO:0000269|PubMed:10718198}.	NA	DISEASE: Epileptic encephalopathy, early infantile, 14 (EIEE14) [MIM:614959]: A rare epileptic encephalopathy of infancy that combines pharmacoresistant seizures with developmental delay. This severe neurologic disorder is characterized by onset in the first 6 months of life of refractory focal seizures and arrest of psychomotor development. Ictal EEG shows discharges that arise randomly from various areas of both hemispheres and migrate from one brain region to another. {ECO:0000269|PubMed:23086397}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Epilepsy, nocturnal frontal lobe, 5 (ENFL5) [MIM:615005]: An autosomal dominant focal epilepsy syndrome characterized by childhood onset of clusters of motor seizures during sleep. Some patients may develop behavioral or psychiatric manifestations and/or intellectual disability. The phenotype is more severe than observed in other genetic forms of nocturnal frontal lobe epilepsy. {ECO:0000269|PubMed:23086396}. Note=The disease is caused by mutations affecting the gene represented in this entry.	98784;293181;	14702039; 15164053; 15489334; 10718198; 20512134; 23086396; 23086397
9	138683984	nonsynonymous	A	G	0.535714285714286	1	KCNT1	TRUE	Q5JUK3	reviewed	Potassium channel subfamily T member 1 (KCa4.1)	KCNT1 KIAA1422	5 out of 5	TISSUE SPECIFICITY: Highest expression in liver, brain and spinal cord. Lowest expression in skeletal muscle. {ECO:0000269|PubMed:10718198}.	NA	DISEASE: Epileptic encephalopathy, early infantile, 14 (EIEE14) [MIM:614959]: A rare epileptic encephalopathy of infancy that combines pharmacoresistant seizures with developmental delay. This severe neurologic disorder is characterized by onset in the first 6 months of life of refractory focal seizures and arrest of psychomotor development. Ictal EEG shows discharges that arise randomly from various areas of both hemispheres and migrate from one brain region to another. {ECO:0000269|PubMed:23086397}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Epilepsy, nocturnal frontal lobe, 5 (ENFL5) [MIM:615005]: An autosomal dominant focal epilepsy syndrome characterized by childhood onset of clusters of motor seizures during sleep. Some patients may develop behavioral or psychiatric manifestations and/or intellectual disability. The phenotype is more severe than observed in other genetic forms of nocturnal frontal lobe epilepsy. {ECO:0000269|PubMed:23086396}. Note=The disease is caused by mutations affecting the gene represented in this entry.	98784;293181;	14702039; 15164053; 15489334; 10718198; 20512134; 23086396; 23086397
9	139658350	nonsynonymous	C	T	0.636363636363636	0	LCN15	TRUE	Q6UWW0	reviewed	Lipocalin-15	LCN15 UNQ2541/PRO6093	2 out of 5	NA	lipid metabolic process [GO:0006629]	NA	NA	12975309; 15164053; 15489334; 
9	139840596	nonsynonymous	G	A	0.423076923076923	0.6	C8G	TRUE	P07360	reviewed	Complement component C8 gamma chain	C8G	5 out of 5	NA	complement activation, alternative pathway [GO:0006957]; complement activation, classical pathway [GO:0006958]; cytolysis [GO:0019835]; regulation of complement activation [GO:0030449]	NA	169150;	3676249; 2447883; 8172891; 15164053; 15489334; 2446620; 1707134; 11058761; 24275569; 12033936; 17452033; 17692377
10	21415036	nonsynonymous	G	A	0.44	0	NEBL	FALSE	O76041	reviewed	Nebulette (Actin-binding Z-disk protein)	NEBL LNEBL	5 out of 5	TISSUE SPECIFICITY: Abundantly expressed in cardiac muscle, but not in skeletal or smooth muscle. Localized to Z-lines in cardiac cells and to dense bodies in nonmuscle cells. Isoform 2 is expressed in non-muscle cells such as in fibroblasts.	cardiac muscle thin filament assembly [GO:0071691]	NA	NA	9733644; 10470015; 15004028; 14702039; 15164054; 15489334; 11140941
10	21415036	nonsynonymous	G	A	0.44	0	C10orf113	TRUE	Q5VZT2	reviewed	Putative uncharacterized protein C10orf113	C10orf113	2 out of 5	NA	NA	NA	NA	15164054; 15489334
10	49219100	nonsynonymous	T	C	0.866666666666667	0.6	AGAP12P	TRUE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
10	70856963	nonsynonymous	C	G	0.555555555555556	0	SRGN	TRUE	P10124	reviewed	Serglycin (Hematopoietic proteoglycan core protein) (Platelet proteoglycan core protein) (P.PG) (Secretory granule proteoglycan core protein)	SRGN PRG PRG1	5 out of 5	NA	biomineral tissue development [GO:0031214]; granzyme-mediated apoptotic signaling pathway [GO:0008626]; maintenance of granzyme B location in T cell secretory granule [GO:0033382]; maintenance of protease location in mast cell secretory granule [GO:0033373]; mast cell secretory granule organization [GO:0033364]; negative regulation of bone mineralization [GO:0030502]; negative regulation of cytokine secretion [GO:0050710]; platelet degranulation [GO:0002576]; protease localization to mast cell secretory granule [GO:0033368]; protein processing [GO:0016485]; T cell secretory granule organization [GO:0033371]	NA	NA	2835370; 2798108; 2180935; 1377686; 14702039; 15164054; 15489334; 3402609; 3214420; 11154222; 11911826; 12388539; 15136585; 16420477; 16870619
10	75434973	nonsynonymous	T	C	0.388888888888889	1	AGAP5	TRUE	A6NIR3	reviewed	Arf-GAP with GTPase, ANK repeat and PH domain-containing protein 5 (AGAP-5) (Centaurin-gamma-like family member 2)	AGAP5 CTGLF2	2 out of 5	NA	NA	NA	NA	15164054; 15489334
10	81850607	nonsynonymous	C	A	0.56	0.6	TMEM254	TRUE	Q8TBM7	reviewed	Transmembrane protein 254	TMEM254 C10orf57	2 out of 5	NA	NA	NA	NA	14702039; 15164054; 15489334; 22814378
10	81925866	nonsynonymous	T	C	0.607142857142857	0.9	ANXA11	TRUE	P50995	reviewed	Annexin A11 (56 kDa autoantigen) (Annexin XI) (Annexin-11) (Calcyclin-associated annexin 50) (CAP-50)	ANXA11 ANX11	5 out of 5	NA	cell cycle [GO:0007049]; cell division [GO:0051301]; phagocytosis [GO:0006909]; response to calcium ion [GO:0051592]	NA	NA	7508441; 11013079; 14702039; 15164054; 15489334; 11883939; 12601007; 12805373; 15197175; 17081065; 18256029; 19608861; 21269460; 24275569; 25944712
10	98741973	nonsynonymous	A	G	0.583333333333333	0.6	C10orf12	TRUE	Q8N655	reviewed	Uncharacterized protein C10orf12	C10orf12	2 out of 5	NA	NA	NA	NA	15164054; 15489334; 14702039; 17974005; 17525332; 18669648; 19413330; 19690332; 20068231; 21406692; 23186163
10	104899197	nonsynonymous	C	G	0.483870967741935	1	NT5C2	TRUE	P49902	reviewed	Cytosolic purine 5'-nucleotidase (EC 3.1.3.5) (Cytosolic 5'-nucleotidase II)	NT5C2 NT5B NT5CP PNT5	5 out of 5	NA	adenosine metabolic process [GO:0046085]; drug metabolic process [GO:0017144]; IMP metabolic process [GO:0046040]; purine nucleotide catabolic process [GO:0006195]	DISEASE: Spastic paraplegia 45, autosomal recessive (SPG45) [MIM:613162]: A form of spastic paraplegia, a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. Some SPG45 patients manifest mental retardation, contractures and learning disability. {ECO:0000269|PubMed:24482476}. Note=The disease is caused by mutations affecting the gene represented in this entry.	320396;	7999131; 14702039; 15164054; 15489334; 18669648; 21269460; 23186163; 24482476; 17405878
10	106014706	nonsynonymous	G	A	0.727272727272727	0	GSTO1	FALSE	P78417	reviewed	Glutathione S-transferase omega-1 (GSTO-1) (EC 2.5.1.18) (Glutathione S-transferase omega 1-1) (GSTO 1-1) (Glutathione-dependent dehydroascorbate reductase) (EC 1.8.5.1) (Monomethylarsonic acid reductase) (MMA(V) reductase) (EC 1.20.4.2) (S-(Phenacyl)glutathione reductase) (SPG-R)	GSTO1 GSTTLP28	5 out of 5	TISSUE SPECIFICITY: Ubiquitous. Highest expression in liver, pancreas, skeletal muscle, spleen, thymus, colon, blood leukocyte and heart. Lowest expression in brain, placenta and lung. {ECO:0000269|PubMed:10783391}.	cellular response to arsenic-containing substance [GO:0071243]; glutathione derivative biosynthetic process [GO:1901687]; glutathione metabolic process [GO:0006749]; L-ascorbic acid biosynthetic process [GO:0019853]; L-ascorbic acid metabolic process [GO:0019852]; methylation [GO:0032259]; negative regulation of ryanodine-sensitive calcium-release channel activity [GO:0060315]; positive regulation of ryanodine-sensitive calcium-release channel activity [GO:0060316]; positive regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion [GO:0014810]; regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion [GO:0010881]; regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum [GO:0010880]; xenobiotic catabolic process [GO:0042178]	NA	NA	10783391; 12928150; 17974005; 15164054; 15489334; 11271497; 11511179; 17226937; 18028863; 19413330; 19608861; 21269460; 24275569; 25944712; 21106529; 12618591
10	115364585	nonsynonymous	A	G	0.55	1	NRAP	TRUE	Q86VF7	reviewed	Nebulin-related-anchoring protein (N-RAP)	NRAP	5 out of 5	TISSUE SPECIFICITY: Expressed in cardiac and skeletal muscle. {ECO:0000269|PubMed:12789664}.	NA	NA	NA	12789664; 17974005; 15164054; 14702039; 15489334; 9339382; 
11	299471	nonsynonymous	C	T	0.5	1	IFITM5	TRUE	A6NNB3	reviewed	Interferon-induced transmembrane protein 5 (Bone-restricted interferon-induced transmembrane protein-like protein) (BRIL) (Dispanin subfamily A member 1) (DSPA1)	IFITM5	5 out of 5	TISSUE SPECIFICITY: Detected in bone (PubMed:24058703). Detected in osteoblasts and fibroblasts (at protein level) (PubMed:24519609). Detected in bone (PubMed:24058703). Detected in osteoblasts and fibroblasts (PubMed:24519609). {ECO:0000269|PubMed:24058703, ECO:0000269|PubMed:24519609}.	bone mineralization [GO:0030282]; bone morphogenesis [GO:0060349]; in utero embryonic development [GO:0001701]; regulation of bone mineralization [GO:0030500]; response to biotic stimulus [GO:0009607]	DISEASE: Osteogenesis imperfecta 5 (OI5) [MIM:610967]: An autosomal dominant form of osteogenesis imperfecta, a connective tissue disorder characterized by low bone mass, bone fragility and susceptibility to fractures after minimal trauma. Disease severity ranges from very mild forms without fractures to intrauterine fractures and perinatal lethality. Extraskeletal manifestations, which affect a variable number of patients, are dentinogenesis imperfecta, hearing loss, and blue sclerae. OI5 patients manifest moderate to severe bone fragility, calcification of the forearm interosseous membrane, radial head dislocation, a subphyseal metaphyseal radiodense line, and hyperplastic callus formation. {ECO:0000269|PubMed:22863190}. Note=The disease is caused by mutations affecting the gene represented in this entry.	216828;	15489334; 22863190; 22363774; 24058703; 24519609
11	1028379	nonsynonymous	C	T	0.433333333333333	1	MUC6	TRUE	Q6W4X9	reviewed	Mucin-6 (MUC-6) (Gastric mucin-6)	MUC6	5 out of 5	TISSUE SPECIFICITY: Expressed in the regenerative zone of gastric antrum, gastric body mucosa and gastric incisura mucosa. Expressed in the deeper mucous glands of gastric antrum. Overexpressed in Helicobacter pylori infected gastric epithelium. Highly expressed in duodenal Brunner's glands, gall bladder, seminal vesicle, pancreatic centroacinar cells and ducts, and periductal glands of the common bile duct. {ECO:0000269|PubMed:10209489, ECO:0000269|PubMed:10330458, ECO:0000269|PubMed:11988092, ECO:0000269|PubMed:15280409, ECO:0000269|PubMed:9422745}.	maintenance of gastrointestinal epithelium [GO:0030277]; O-glycan processing [GO:0016266]	NA	NA	16554811; 15081123; 7680650; 14702039; 9195947; 9422745; 10209489; 10330458; 11988092; 15280409; 15979574
11	6424610	nonsynonymous	T	C	0.555555555555556	1	APBB1	TRUE	O00213	reviewed	Amyloid beta A4 precursor protein-binding family B member 1 (Protein Fe65)	APBB1 FE65 RIR	5 out of 5	TISSUE SPECIFICITY: Highly expressed in brain; strongly reduced in post-mortem elderly subjects with Alzheimer disease. {ECO:0000269|PubMed:19343227}.	apoptotic process [GO:0006915]; axonogenesis [GO:0007409]; cell cycle arrest [GO:0007050]; cellular response to DNA damage stimulus [GO:0006974]; double-strand break repair [GO:0006302]; histone H4 acetylation [GO:0043967]; negative regulation of cell growth [GO:0030308]; negative regulation of thymidylate synthase biosynthetic process [GO:0050760]; positive regulation of apoptotic process [GO:0043065]; positive regulation of DNA repair [GO:0045739]; positive regulation of neuron projection development [GO:0010976]; positive regulation of protein secretion [GO:0050714]; positive regulation of transcription, DNA-templated [GO:0045893]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; regulation of transcription, DNA-templated [GO:0006355]; response to iron ion [GO:0010039]; signal transduction [GO:0007165]; transcription, DNA-templated [GO:0006351]	NA	NA	8894693; 9799084; 21824145; 14702039; 17974005; 16554811; 15489334; 15031292; 17512906; 18468999; 18922798; 19234442; 19343227; 17686488; 18833287; 18550529
11	6625566	nonsynonymous	A	G	0.423076923076923	1	ILK	TRUE	Q13418	reviewed	Integrin-linked protein kinase (EC 2.7.11.1) (59 kDa serine/threonine-protein kinase) (ILK-1) (ILK-2) (p59ILK)	ILK ILK1 ILK2	5 out of 5	TISSUE SPECIFICITY: Highly expressed in heart followed by skeletal muscle, pancreas and kidney. Weakly expressed in placenta, lung and liver.	branching involved in ureteric bud morphogenesis [GO:0001658]; cell aging [GO:0007569]; cell cycle arrest [GO:0007050]; cell junction assembly [GO:0034329]; cell-matrix adhesion [GO:0007160]; cell proliferation [GO:0008283]; establishment or maintenance of epithelial cell apical/basal polarity [GO:0045197]; extracellular fibril organization [GO:0043206]; fibroblast migration [GO:0010761]; integrin-mediated signaling pathway [GO:0007229]; myelin assembly [GO:0032288]; myelination in peripheral nervous system [GO:0022011]; negative regulation of cardiac muscle cell apoptotic process [GO:0010667]; negative regulation of neural precursor cell proliferation [GO:2000178]; negative regulation of neuron apoptotic process [GO:0043524]; negative regulation of protein kinase activity [GO:0006469]; negative regulation of smooth muscle cell migration [GO:0014912]; negative regulation of smooth muscle cell proliferation [GO:0048662]; nerve development [GO:0021675]; neuron projection morphogenesis [GO:0048812]; outflow tract morphogenesis [GO:0003151]; peptidyl-serine phosphorylation [GO:0018105]; platelet aggregation [GO:0070527]; positive regulation of axon extension [GO:0045773]; positive regulation of BMP signaling pathway [GO:0030513]; positive regulation of canonical Wnt signaling pathway [GO:0090263]; positive regulation of cell-matrix adhesion [GO:0001954]; positive regulation of cell migration [GO:0030335]; positive regulation of cell proliferation [GO:0008284]; positive regulation of dendrite morphogenesis [GO:0050775]; positive regulation of MAP kinase activity [GO:0043406]; positive regulation of myoblast differentiation [GO:0045663]; positive regulation of osteoblast differentiation [GO:0045669]; positive regulation of phosphorylation [GO:0042327]; positive regulation of protein kinase B signaling [GO:0051897]; positive regulation of transcription, DNA-templated [GO:0045893]; protein heterooligomerization [GO:0051291]; protein kinase B signaling [GO:0043491]; protein phosphorylation [GO:0006468]; regulation of actin cytoskeleton organization [GO:0032956]; substrate adhesion-dependent cell spreading [GO:0034446]	NA	NA	8538749; 10871859; 14702039; 17974005; 16554811; 15489334; 9736715; 10712922; 11402068; 12167643; 15284246; 19118217; 21269460; 21406692; 22223895; 22814378; 25944712; 19074270; 19117955; 20005845; 20117114; 17646580
11	6737974	nonsynonymous	A	G	0.333333333333333	0.7	GVINP1	TRUE	Q7Z2Y8	reviewed	Interferon-induced very large GTPase 1 (Interferon-induced very large GTPase pseudogene 1)	GVINP1 GVIN1 VLIG1	2 out of 5	NA	NA	NA	NA	16554811; 17974005; 14702039
11	10582240	nonsynonymous	A	G	0.405405405405405	0	MRVI1-AS1	FALSE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
11	10582240	nonsynonymous	A	G	0.405405405405405	0	LYVE1	TRUE	Q9Y5Y7	reviewed	Lymphatic vessel endothelial hyaluronic acid receptor 1 (LYVE-1) (Cell surface retention sequence-binding protein 1) (CRSBP-1) (Extracellular link domain-containing protein 1) (Hyaluronic acid receptor)	LYVE1 CRSBP1 HAR XLKD1 UNQ230/PRO263	5 out of 5	TISSUE SPECIFICITY: Mainly expressed in endothelial cells lining lymphatic vessels. {ECO:0000269|PubMed:10037799}.	anatomical structure morphogenesis [GO:0009653]; cell-matrix adhesion [GO:0007160]; hyaluronan catabolic process [GO:0030214]; movement of cell or subcellular component [GO:0006928]; response to wounding [GO:0009611]; transport [GO:0006810]	NA	NA	10037799; 12975309; 15489334; 16335952; 19159218
11	18253104	nonsynonymous	C	T	0.555555555555556	0.7	SAA2-SAA4	TRUE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
11	18253104	nonsynonymous	C	T	0.555555555555556	0.7	SAA4	TRUE	P35542	reviewed	Serum amyloid A-4 protein (Constitutively expressed serum amyloid A protein) (C-SAA)	SAA4 CSAA	4 out of 5	TISSUE SPECIFICITY: Expressed by the liver; secreted in plasma.	acute-phase response [GO:0006953]; cell chemotaxis [GO:0060326]	NA	NA	1740433; 7686132; 1439582; 16554811; 15489334; 8783012; 16335952; 19159218; 22028381
11	55322818	nonsense	G	T	0.625	1	OR4C15	TRUE	Q8NGM1	reviewed	Olfactory receptor 4C15 (Olfactory receptor OR11-127) (Olfactory receptor OR11-134)	OR4C15	3 out of 5	NA	detection of chemical stimulus involved in sensory perception [GO:0050907]; G-protein coupled receptor signaling pathway [GO:0007186]	NA	NA	16554811; 14983052
11	56143898	nonsynonymous	GCCCTGGACA	TCTCTTGATG	0.485714285714286	0	OR8U8	FALSE	P0C7N1	reviewed	Olfactory receptor 8U8	OR8U8	3 out of 5	NA	G-protein coupled receptor signaling pathway [GO:0007186]	NA	NA	NA
11	56143898	nonsynonymous	GCCCTGGACA	TCTCTTGATG	0.485714285714286	0	OR8U1	TRUE	Q8NH10	reviewed	Olfactory receptor 8U1	OR8U1	4 out of 5	NA	G-protein coupled receptor signaling pathway [GO:0007186]	NA	NA	NA
11	56237553	nonsense	G	A	0.5	0	OR5M3	TRUE	Q8NGP4	reviewed	Olfactory receptor 5M3 (Olfactory receptor OR11-191)	OR5M3	3 out of 5	NA	G-protein coupled receptor signaling pathway [GO:0007186]	NA	NA	15489334; 12213199; 14983052
11	61313545	nonsynonymous	G	A	0.533333333333333	1	SYT7	TRUE	O43581	reviewed	Synaptotagmin-7 (IPCA-7) (Prostate cancer-associated protein 7) (Synaptotagmin VII) (SytVII)	SYT7 PCANAP7	5 out of 5	TISSUE SPECIFICITY: Expressed in a variety of adult and fetal tissues.	calcium ion-regulated exocytosis of neurotransmitter [GO:0048791]; calcium ion regulated lysosome exocytosis [GO:1990927]; phagocytosis [GO:0006909]; phagosome-lysosome fusion [GO:0090385]; plasma membrane repair [GO:0001778]; positive regulation of calcium ion-dependent exocytosis [GO:0045956]; regulation of bone remodeling [GO:0046850]; regulation of calcium ion-dependent exocytosis [GO:0017158]; regulation of glucagon secretion [GO:0070092]; regulation of insulin secretion [GO:0050796]; regulation of phagocytosis [GO:0050764]; synaptic vesicle recycling [GO:0036465]; vesicle fusion [GO:0006906]; vesicle-mediated cholesterol transport [GO:0090119]	NA	NA	9615227; 16554811; 15489334; 11342594; 12071850; 15811535; 22966849; 25437758; 26322740; 26333120; 
11	71146837	nonsynonymous	C	T	0.366666666666667	0	DHCR7	TRUE	Q9UBM7	reviewed	7-dehydrocholesterol reductase (7-DHC reductase) (EC 1.3.1.21) (Putative sterol reductase SR-2) (Sterol Delta(7)-reductase)	DHCR7 D7SR	5 out of 5	TISSUE SPECIFICITY: Most abundant in adrenal gland, liver, testis, and brain. {ECO:0000269|PubMed:9878250}.	blood vessel development [GO:0001568]; cell differentiation [GO:0030154]; cholesterol biosynthetic process [GO:0006695]; cholesterol biosynthetic process via desmosterol [GO:0033489]; cholesterol biosynthetic process via lathosterol [GO:0033490]; lung development [GO:0030324]; multicellular organism growth [GO:0035264]; post-embryonic development [GO:0009791]; regulation of cell proliferation [GO:0042127]; regulation of cholesterol biosynthetic process [GO:0045540]	DISEASE: Smith-Lemli-Opitz syndrome (SLOS) [MIM:270400]: An autosomal recessive frequent inborn disorder of sterol metabolism with characteristic congenital malformations and mental retardation. Children with SLOS have elevated serum 7-dehydrocholesterol (7-DHC) levels and low serum cholesterol levels. SLOS occurs in relatively high frequency: approximately 1 in 20,000 to 30,000 births in populations of northern and central European background. Historically, a clinical distinction often was made between classic ('type I') SLOS and the more severely affected ('type II') patients. There is, in reality, a clinical and biochemical continuum from mild to severe SLOS. {ECO:0000269|PubMed:10677299, ECO:0000269|PubMed:10995508, ECO:0000269|PubMed:11175299, ECO:0000269|PubMed:11427181, ECO:0000269|PubMed:12949967, ECO:0000269|PubMed:15954111, ECO:0000269|PubMed:9653161, ECO:0000269|PubMed:9683613}. Note=The disease is caused by mutations affecting the gene represented in this entry.	818;	9683613; 9465114; 9878250; 14702039; 15489334; 9634533; 18691976; 19369195; 19690332; 20068231; 21269460; 21406692; 22814378; 23186163; 24275569; 25944712; 9653161; 10677299; 10995508; 11427181; 11175299; 12949967; 15954111; 25787250
11	74570248	nonsynonymous	G	C	0.6	1	XRRA1	FALSE	Q6P2D8	reviewed	X-ray radiation resistance-associated protein 1	XRRA1	4 out of 5	TISSUE SPECIFICITY: Expressed predominantly in testis followed by prostate and ovary. Low levels found in other tissues including peripheral blood leukocytes, spleen, thymus, small intestine and colon. Also expressed in neuroblastoma, glioma, breast, lung, leukemia, renal, ovarian, prostate and colorectal cancer cell lines. {ECO:0000269|PubMed:12908878}.	response to X-ray [GO:0010165]	NA	NA	16554811; 15489334; 12908878; 
11	75115893	nonsynonymous	C	A	0.666666666666667	1	RPS3	TRUE	P23396	reviewed	40S ribosomal protein S3 (EC 4.2.99.18)	RPS3 OK/SW-cl.26	5 out of 5	NA	cell division [GO:0051301]; cellular response to DNA damage stimulus [GO:0006974]; cellular response to hydrogen peroxide [GO:0070301]; chromosome segregation [GO:0007059]; DNA damage response, detection of DNA damage [GO:0042769]; DNA repair [GO:0006281]; mitotic nuclear division [GO:0007067]; negative regulation of DNA repair [GO:0045738]; negative regulation of protein ubiquitination [GO:0031397]; negative regulation of translation [GO:0017148]; nuclear-transcribed mRNA catabolic process, nonsense-mediated decay [GO:0000184]; positive regulation of apoptotic signaling pathway [GO:2001235]; positive regulation of base-excision repair [GO:1905053]; positive regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis [GO:2001272]; positive regulation of DNA N-glycosylase activity [GO:1902546]; positive regulation of DNA repair [GO:0045739]; positive regulation of endodeoxyribonuclease activity [GO:0032079]; positive regulation of gene expression [GO:0010628]; positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage [GO:1902231]; positive regulation of JUN kinase activity [GO:0043507]; positive regulation of microtubule polymerization [GO:0031116]; positive regulation of NIK/NF-kappaB signaling [GO:1901224]; regulation of apoptotic process [GO:0042981]; regulation of transcription, DNA-templated [GO:0006355]; response to oxidative stress [GO:0006979]; response to TNF agonist [GO:0061481]; rRNA processing [GO:0006364]; spindle assembly [GO:0051225]; SRP-dependent cotranslational protein targeting to membrane [GO:0006614]; transcription, DNA-templated [GO:0006351]; translation [GO:0006412]; translational initiation [GO:0006413]; viral transcription [GO:0019083]	NA	NA	2129557; 1712897; 11875025; 14702039; 16554811; 15489334; 8319909; 8706699; 7775413; 15518571; 14706345; 14988002; 15707971; 15950189; 17081983; 16737853; 16314389; 16964243; 16807684; 18045535; 17049931; 17560175; 17289661; 18610840; 18691976; 18973764; 18669648; 19413330; 19460357; 19059439; 19656744; 19369195; 20041225; 19541769; 19690332; 19608861; 20605787; 20217897; 20068231; 21269460; 21968017; 21871177; 21399639; 21406692; 22510408; 23131551; 22814378; 23911537; 23186163; 24457201; 24275569; 24423872; 25114211; 25944712; 23636399
11	111796904	nonsynonymous	A	G	0.555555555555556	1	HSPB2-C11orf52	TRUE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
11	111796904	nonsynonymous	A	G	0.555555555555556	1	C11orf52	TRUE	Q96A22	reviewed	Uncharacterized protein C11orf52	C11orf52	2 out of 5	NA	NA	NA	NA	14702039; 16554811; 15489334; 24275569
11	124007900	nonsynonymous	C	T	0.428571428571429	1	VWA5A	TRUE	O00534	reviewed	von Willebrand factor A domain-containing protein 5A (Breast cancer suppressor candidate 1) (BCSC-1) (Loss of heterozygosity 11 chromosomal region 2 gene A protein)	VWA5A BCSC1 LOH11CR2A	4 out of 5	TISSUE SPECIFICITY: Expressed at low level in many tissues. Not expressed in 80% of tumor cell lines tested. {ECO:0000269|PubMed:14504409}.	NA	NA	NA	14504409; 15489334; 9417908
11	133779031	nonsynonymous	G	A	0.44	1	IGSF9B	TRUE	Q9UPX0	reviewed	Protein turtle homolog B (Immunoglobulin superfamily member 9B) (IgSF9B)	IGSF9B KIAA1030	5 out of 5	NA	homophilic cell adhesion via plasma membrane adhesion molecules [GO:0007156]; nervous system development [GO:0007399]; positive regulation of inhibitory postsynaptic potential [GO:0097151]	NA	NA	16554811; 10470851
12	2943924	nonsense	G	A	0.529411764705882	1	NRIP2	TRUE	Q9BQI9	reviewed	Nuclear receptor-interacting protein 2	NRIP2	3 out of 5	NA	regulation of transcription, DNA-templated [GO:0006355]; transcription, DNA-templated [GO:0006351]	NA	NA	11230166; 14702039; 16541075; 15489334
12	21639421	nonsynonymous	T	A	0.392857142857143	1	RECQL	TRUE	P46063	reviewed	ATP-dependent DNA helicase Q1 (EC 3.6.4.12) (DNA helicase, RecQ-like type 1) (RecQ1) (DNA-dependent ATPase Q1) (RecQ protein-like 1)	RECQL RECQ1 RECQL1	5 out of 5	TISSUE SPECIFICITY: High expression in heart, lung, skeletal muscle and kidney, low expression in brain. {ECO:0000269|PubMed:7961977}.	DNA repair [GO:0006281]; DNA strand renaturation [GO:0000733]; double-strand break repair via homologous recombination [GO:0000724]	NA	NA	7961977; 7527136; 14702039; 16541075; 15489334; 8056767; 15886194; 19608861; 20068231; 21269460; 23186163; 24275569
12	52402998	nonsynonymous	C	T	0.666666666666667	0.8	GRASP	TRUE	Q7Z6J2	reviewed	General receptor for phosphoinositides 1-associated scaffold protein (GRP1-associated scaffold protein)	GRASP	3 out of 5	NA	protein localization [GO:0008104]; signal transduction [GO:0007165]	NA	NA	15489334; 19690332
12	52681460	nonsynonymous	G	A	0.633333333333333	0	KRT86	FALSE	O43790	reviewed	Keratin, type II cuticular Hb6 (Hair keratin K2.11) (Keratin-86) (K86) (Type II hair keratin Hb6) (Type-II keratin Kb26)	KRT86 KRTHB6	5 out of 5	TISSUE SPECIFICITY: Synthesis begins slightly higher in the hair shaft than HB1 and HB3 and continues much farther up, ending in the keratogeneous zone. {ECO:0000269|PubMed:9084137}.	NA	DISEASE: Monilethrix (MNLIX) [MIM:158000]: A disorder clinically characterized by alopecia and follicular papules. Affected hairs have uniform elliptical nodes of normal thickness and intermittent constrictions, internodes at which the hair easily breaks. Usually only the scalp is involved, but in severe forms, the secondary sexual hair, eyebrows, eyelashes, and nails may also be affected. {ECO:0000269|PubMed:10469314, ECO:0000269|PubMed:10504448, ECO:0000269|PubMed:10594761, ECO:0000269|PubMed:25557232, ECO:0000269|PubMed:9402962}. Note=The disease is caused by mutations affecting the gene represented in this entry.	573;	9457912; 15489334; 9084137; 9402962; 10469314; 10504448; 10594761; 25557232
12	52681460	nonsynonymous	G	A	0.633333333333333	0	KRT81	TRUE	Q14533	reviewed	Keratin, type II cuticular Hb1 (Hair keratin K2.9) (Keratin, hair, basic, 1) (Keratin-81) (K81) (Metastatic lymph node 137 gene protein) (MLN 137) (Type II hair keratin Hb1) (Type-II keratin Kb21) (ghHKb1) (ghHb1)	KRT81 KRTHB1 MLN137	5 out of 5	TISSUE SPECIFICITY: Abundantly expressed in the differentiating cortex of growing (anagen) hair. Expression is restricted to the keratinocytes of the hair cortex and is absent from inner root sheath and medulla. Expressed in malignant lymph node tissue in breast carcinoma tissue. {ECO:0000269|PubMed:7490069, ECO:0000269|PubMed:7528047, ECO:0000269|PubMed:9457912}.	NA	DISEASE: Monilethrix (MNLIX) [MIM:158000]: A disorder clinically characterized by alopecia and follicular papules. Affected hairs have uniform elliptical nodes of normal thickness and intermittent constrictions, internodes at which the hair easily breaks. Usually only the scalp is involved, but in severe forms, the secondary sexual hair, eyebrows, eyelashes, and nails may also be affected. {ECO:0000269|PubMed:25557232, ECO:0000269|PubMed:9402962, ECO:0000269|PubMed:9665406}. Note=The disease is caused by mutations affecting the gene represented in this entry.	573;	9457912; 16541075; 15489334; 7556444; 7490069; 7528047; 9402962; 9665406; 25557232
12	64174904	nonsynonymous	C	T	0.538461538461538	0.4	TMEM5	TRUE	Q9Y2B1	reviewed	Transmembrane protein 5	TMEM5	4 out of 5	NA	protein O-linked mannosylation [GO:0035269]	DISEASE: Muscular dystrophy-dystroglycanopathy congenital with brain and eye anomalies A10 (MDDGA10) [MIM:615041]: An autosomal recessive disorder characterized by congenital muscular dystrophy associated with cobblestone lissencephaly and other brain anomalies, eye malformations, profound mental retardation, and death usually in the first years of life. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. {ECO:0000269|PubMed:23217329, ECO:0000269|PubMed:23519211}. Note=The disease is caused by mutations affecting the gene represented in this entry.	899;	10072769; 14702039; 15489334; 23186163; 23519211; 25279699; 23217329
12	77423627	nonsynonymous	G	A	0.472222222222222	1	E2F7	TRUE	Q96AV8	reviewed	Transcription factor E2F7 (E2F-7)	E2F7	5 out of 5	NA	chorionic trophoblast cell differentiation [GO:0060718]; DNA damage response, signal transduction by p53 class mediator [GO:0030330]; DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest [GO:0006977]; hepatocyte differentiation [GO:0070365]; negative regulation of cell proliferation [GO:0008285]; negative regulation of cytokinesis [GO:0032466]; negative regulation of G1/S transition of mitotic cell cycle [GO:2000134]; negative regulation of transcription from RNA polymerase II promoter [GO:0000122]; negative regulation of transcription involved in G1/S transition of mitotic cell cycle [GO:0071930]; placenta development [GO:0001890]; positive regulation of DNA endoreduplication [GO:0032877]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; sprouting angiogenesis [GO:0002040]; transcription, DNA-templated [GO:0006351]; trophoblast giant cell differentiation [GO:0060707]	NA	NA	16541075; 15489334; 14702039; 14633988; 15133492; 18194653; 18202719; 18669648; 20068231; 22903062; 19223542; 21248772; 22802528; 22802529; 23186163
12	99071283	nonsynonymous	A	C	0.64	0.6	APAF1	TRUE	O14727	reviewed	Apoptotic protease-activating factor 1 (APAF-1)	APAF1 KIAA0413	5 out of 5	TISSUE SPECIFICITY: Ubiquitous. Highest levels of expression in adult spleen and peripheral blood leukocytes, and in fetal brain, kidney and lung. Isoform 1 is expressed in heart, kidney and liver.	activation of cysteine-type endopeptidase activity involved in apoptotic process [GO:0006919]; activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c [GO:0008635]; aging [GO:0007568]; apoptotic process [GO:0006915]; cardiac muscle cell apoptotic process [GO:0010659]; cell differentiation [GO:0030154]; cellular response to transforming growth factor beta stimulus [GO:0071560]; forebrain development [GO:0030900]; glial cell apoptotic process [GO:0034349]; intrinsic apoptotic signaling pathway [GO:0097193]; intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress [GO:0070059]; nervous system development [GO:0007399]; neural tube closure [GO:0001843]; neuron apoptotic process [GO:0051402]; positive regulation of apoptotic process [GO:0043065]; positive regulation of apoptotic signaling pathway [GO:2001235]; protein homooligomerization [GO:0051260]; regulation of apoptotic DNA fragmentation [GO:1902510]; regulation of apoptotic process [GO:0042981]; response to G1 DNA damage checkpoint signaling [GO:0072432]; response to hypoxia [GO:0001666]; response to nutrient [GO:0007584]	NA	NA	9267021; 10441496; 10364241; 10393175; 12804598; 9455477; 12168954; 15489334; 9651578; 11389439; 15262985; 17244527; 21371431; 10543941; 10578182
12	103234252	nonsynonymous	T	C	0.75	1	PAH	TRUE	P00439	reviewed	Phenylalanine-4-hydroxylase (PAH) (EC 1.14.16.1) (Phe-4-monooxygenase)	PAH	5 out of 5	NA	catecholamine biosynthetic process [GO:0042423]; cellular amino acid biosynthetic process [GO:0008652]; L-phenylalanine catabolic process [GO:0006559]; neurotransmitter biosynthetic process [GO:0042136]; protein hydroxylation [GO:0018126]; tetrahydrobiopterin metabolic process [GO:0046146]; tyrosine biosynthetic process [GO:0006571]	DISEASE: Phenylketonuria (PKU) [MIM:261600]: Autosomal recessive inborn error of phenylalanine metabolism, due to severe phenylalanine hydroxylase deficiency. It is characterized by blood concentrations of phenylalanine persistently above 1200 mumol (normal concentration 100 mumol) which usually causes mental retardation (unless low phenylalanine diet is introduced early in life). They tend to have light pigmentation, rashes similar to eczema, epilepsy, extreme hyperactivity, psychotic states and an unpleasant 'mousy' odor. {ECO:0000269|PubMed:10200057, ECO:0000269|PubMed:10679941, ECO:0000269|PubMed:11180595, ECO:0000269|PubMed:11385716, ECO:0000269|PubMed:11461196, ECO:0000269|PubMed:12501224, ECO:0000269|PubMed:1355066, ECO:0000269|PubMed:1363837, ECO:0000269|PubMed:1363838, ECO:0000269|PubMed:1671810, ECO:0000269|PubMed:1672290, ECO:0000269|PubMed:1672294, ECO:0000269|PubMed:1679030, ECO:0000269|PubMed:1709636, ECO:0000269|PubMed:1975559, ECO:0000269|PubMed:2014802, ECO:0000269|PubMed:22513348, ECO:0000269|PubMed:22526846, ECO:0000269|PubMed:23792259, ECO:0000269|PubMed:2564729, ECO:0000269|PubMed:2615649, ECO:0000269|PubMed:2840952, ECO:0000269|PubMed:7833954, ECO:0000269|PubMed:8068076, ECO:0000269|PubMed:8406445, ECO:0000269|PubMed:8889590, ECO:0000269|PubMed:9048935, ECO:0000269|PubMed:9101291, ECO:0000269|PubMed:9452061, ECO:0000269|PubMed:9452062, ECO:0000269|PubMed:9521426, ECO:0000269|PubMed:9600453, ECO:0000269|PubMed:9792407, ECO:0000269|PubMed:9950317}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Non-phenylketonuria hyperphenylalaninemia (Non-PKU HPA) [MIM:261600]: Mild form of phenylalanine hydroxylase deficiency characterized by phenylalanine levels persistently below 600 mumol, which allows normal intellectual and behavioral development without treatment. Non-PKU HPA is usually caused by the combined effect of a mild hyperphenylalaninemia mutation and a severe one. {ECO:0000269|PubMed:1358789, ECO:0000269|PubMed:8088845, ECO:0000269|PubMed:8098245, ECO:0000269|PubMed:9521426, ECO:0000269|PubMed:9852673}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Hyperphenylalaninemia (HPA) [MIM:261600]: Mildest form of phenylalanine hydroxylase deficiency. {ECO:0000269|PubMed:11385716, ECO:0000269|PubMed:11935335, ECO:0000269|PubMed:12501224, ECO:0000269|PubMed:1358789, ECO:0000269|PubMed:23792259, ECO:0000269|PubMed:8088845, ECO:0000269|PubMed:8098245, ECO:0000269|PubMed:9521426, ECO:0000269|PubMed:9852673}. Note=The disease is caused by mutations affecting the gene represented in this entry.	79254;2209;79651;79253;293284;	2986678; 15489334; 2461704; 12185072; 18835579; 21269460; 24275569; 9406548; 9843368; 9642259; 10694386; 11718561; 1679029; 2246858; 1301187; 8594560; 2840952; 2564729; 2615649; 1975559; 1671810; 2014802; 1672294; 1672290; 1679030; 1709636; 1358789; 1355066; 1363837; 1363838; 8406445; 8098245; 8364546; 8068076; 8088845; 7833954; 8889583; 8889590; 9048935; 9101291; 9450897; 9521426; 9600453; 10200057; 9452061; 9452062; 9792407; 9792411; 9852673; 9950317; 10679941; 11326337; 11180595; 11385716; 11461196; 11935335; 12501224; 18538294; 23792259; 22526846; 22513348
12	121004739	nonsynonymous	C	T	0.523809523809524	0	RNF10	TRUE	Q8N5U6	reviewed	RING finger protein 10	RNF10 KIAA0262 RIE2	5 out of 5	NA	negative regulation of Schwann cell proliferation [GO:0010626]; positive regulation of myelination [GO:0031643]; positive regulation of transcription, DNA-templated [GO:0045893]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; protein autoubiquitination [GO:0051865]; transcription, DNA-templated [GO:0006351]	NA	NA	10697961; 9039502; 12168954; 15489334; 16335786; 23186163
12	133201381	nonsynonymous	T	A	0.35	1	POLE	TRUE	Q07864	reviewed	DNA polymerase epsilon catalytic subunit A (EC 2.7.7.7) (DNA polymerase II subunit A)	POLE POLE1	5 out of 5	NA	base-excision repair, gap-filling [GO:0006287]; DNA replication [GO:0006260]; DNA replication initiation [GO:0006270]; DNA synthesis involved in DNA repair [GO:0000731]; embryonic organ development [GO:0048568]; G1/S transition of mitotic cell cycle [GO:0000082]; nucleotide-excision repair, DNA gap filling [GO:0006297]; telomere maintenance via recombination [GO:0000722]	DISEASE: Colorectal cancer 12 (CRCS12) [MIM:615083]: A complex disease characterized by malignant lesions arising from the inner wall of the large intestine (the colon) and the rectum. Genetic alterations are often associated with progression from premalignant lesion (adenoma) to invasive adenocarcinoma. Risk factors for cancer of the colon and rectum include colon polyps, long-standing ulcerative colitis, and genetic family history. CRCS12 is characterized by a high-penetrance predisposition to the development of colorectal adenomas and carcinomas, with a variable tendency to develop multiple and large tumors. Onset is usually before age 40 years. The histologic features of the tumors are unremarkable. {ECO:0000269|PubMed:23263490, ECO:0000269|PubMed:24501277}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.; DISEASE: Facial dysmorphism, immunodeficiency, livedo, and short stature (FILS) [MIM:615139]: A syndrome characterized by mild facial dysmorphism, mainly malar hypoplasia, livedo on the skin since birth, and immunodeficiency resulting in recurrent infections. Growth impairment is observed during early childhood and results in variable short stature in adulthood. {ECO:0000269|PubMed:23230001}. Note=The disease is caused by mutations affecting the gene represented in this entry.	352712;	8486689; 10801849; 11395493; 14500819; 17525332; 20068231; 21269460; 23230001; 23186163; 23263490; 24501277
13	25670953	nonsynonymous	GCC	ACT	0.244444444444444	1	PABPC3	TRUE	Q9H361	reviewed	Polyadenylate-binding protein 3 (PABP-3) (Poly(A)-binding protein 3) (Testis-specific poly(A)-binding protein)	PABPC3 PABP3 PABPL3	3 out of 5	TISSUE SPECIFICITY: Testis specific. {ECO:0000269|PubMed:11328870}.	mRNA metabolic process [GO:0016071]	NA	NA	11328870; 11230166; 15489334; 
13	25670978	nonsynonymous	CGGGCCCGCCT	TGGCCCTGCCG	0.317073170731707	1	PABPC3	TRUE	Q9H361	reviewed	Polyadenylate-binding protein 3 (PABP-3) (Poly(A)-binding protein 3) (Testis-specific poly(A)-binding protein)	PABPC3 PABP3 PABPL3	3 out of 5	TISSUE SPECIFICITY: Testis specific. {ECO:0000269|PubMed:11328870}.	mRNA metabolic process [GO:0016071]	NA	NA	11328870; 11230166; 15489334; 
13	25842016	nonsynonymous	C	G	0.551724137931034	1	MTMR6	TRUE	Q9Y217	reviewed	Myotubularin-related protein 6 (EC 3.1.3.-)	MTMR6	5 out of 5	TISSUE SPECIFICITY: Expressed in CD4+ T-cells. {ECO:0000269|PubMed:16847315}.	phosphatidylinositol biosynthetic process [GO:0006661]; phosphatidylinositol dephosphorylation [GO:0046856]; protein dephosphorylation [GO:0006470]	NA	NA	12890864; 14702039; 17974005; 15057823; 15489334; 9736772; 15831468; 16787938; 16847315; 18669648; 23145062; 23186163; 24275569
13	31712572	nonsynonymous	C	T	0.481481481481481	0.9	HSPH1	TRUE	Q92598	reviewed	Heat shock protein 105 kDa (Antigen NY-CO-25) (Heat shock 110 kDa protein)	HSPH1 HSP105 HSP110 KIAA0201	5 out of 5	TISSUE SPECIFICITY: Highly expressed in testis. Present at lower levels in most brain regions, except cerebellum. Overexpressed in cancer cells. {ECO:0000269|PubMed:10865058, ECO:0000269|PubMed:16232202}.	chaperone mediated protein folding requiring cofactor [GO:0051085]; negative regulation of establishment of protein localization to mitochondrion [GO:1903748]; negative regulation of intrinsic apoptotic signaling pathway in response to hydrogen peroxide [GO:1903751]; negative regulation of p38MAPK cascade [GO:1903753]; positive regulation of MHC class I biosynthetic process [GO:0045345]; positive regulation of NK T cell activation [GO:0051135]; positive regulation of protein tyrosine kinase activity [GO:0061098]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; receptor-mediated endocytosis [GO:0006898]; regulation of cellular response to heat [GO:1900034]; response to unfolded protein [GO:0006986]	NA	NA	9931472; 9610721; 9039502; 14702039; 15057823; 15489334; 10865058; 16232202; 17081983; 18669648; 19413330; 19369195; 20068231; 21269460; 21406692; 22223895; 23186163; 24275569
13	32352714	nonsynonymous	A	G	0.428571428571429	1	RXFP2	TRUE	Q8WXD0	reviewed	Relaxin receptor 2 (G-protein coupled receptor 106) (G-protein coupled receptor affecting testicular descent) (Leucine-rich repeat-containing G-protein coupled receptor 8) (Relaxin family peptide receptor 2)	RXFP2 GPR106 GREAT LGR8	5 out of 5	TISSUE SPECIFICITY: Expressed mainly in the brain, kidney, muscle, testis, thyroid, uterus, peripheral blood cells and bone marrow.	adenylate cyclase-activating G-protein coupled receptor signaling pathway [GO:0007189]; adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway [GO:0007193]; adenylate cyclase-modulating G-protein coupled receptor signaling pathway [GO:0007188]; male gonad development [GO:0008584]; negative regulation of apoptotic process [GO:0043066]; negative regulation of cell proliferation [GO:0008285]; oocyte maturation [GO:0001556]; positive regulation of cAMP biosynthetic process [GO:0030819]	DISEASE: Cryptorchidism (CRYPTO) [MIM:219050]: One of the most frequent congenital abnormalities in humans, involving 2-5% of male births. Cryptorchidism is associated with increased risk of infertility and testicular cancer. {ECO:0000269|PubMed:12217959}. Note=The disease is caused by mutations affecting the gene represented in this entry.	NA	11809971; 12217959; 16051677; 15057823; 
13	45149445	nonsynonymous	T	C	0.466666666666667	1	TSC22D1	TRUE	Q15714	reviewed	TSC22 domain family protein 1 (Cerebral protein 2) (Regulatory protein TSC-22) (TGFB-stimulated clone 22 homolog) (Transforming growth factor beta-1-induced transcript 4 protein)	TSC22D1 KIAA1994 TGFB1I4 TSC22 hucep-2	5 out of 5	TISSUE SPECIFICITY: Widely expressed in fetal and adult tissues.	transcription from RNA polymerase II promoter [GO:0006366]	NA	NA	8651929; 9022669; 9026990; 12056414; 14702039; 17974005; 15057823; 15489334; 10488076; 19690332; 21269460
13	52603448	nonsynonymous	A	G	0.526315789473684	0	ALG11	TRUE	Q2TAA5	reviewed	GDP-Man:Man(3)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase (EC 2.4.1.131) (Asparagine-linked glycosylation protein 11 homolog) (Glycolipid 2-alpha-mannosyltransferase)	ALG11 GT8	5 out of 5	NA	NA	DISEASE: Congenital disorder of glycosylation 1P (CDG1P) [MIM:613661]: A multisystem disorder caused by a defect in glycoprotein biosynthesis and characterized by under-glycosylated serum glycoproteins. Congenital disorders of glycosylation result in a wide variety of clinical features, such as defects in the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. {ECO:0000269|PubMed:20080937, ECO:0000269|PubMed:22213132}. Note=The disease is caused by mutations affecting the gene represented in this entry.	280071;	14702039; 15057823; 15489334; 20080937; 22213132
13	52603448	nonsynonymous	A	G	0.526315789473684	0	UTP14C	TRUE	Q5TAP6	reviewed	U3 small nucleolar RNA-associated protein 14 homolog C	UTP14C KIAA0266	4 out of 5	TISSUE SPECIFICITY: Expressed in testis. {ECO:0000269|PubMed:15289605}.	cell differentiation [GO:0030154]; maturation of SSU-rRNA [GO:0030490]; meiotic cell cycle [GO:0051321]; multicellular organism development [GO:0007275]; spermatogenesis [GO:0007283]	NA	NA	9039502; 15057823; 15489334; 15289605; 19413330
13	76334893	nonsynonymous	A	G	0.4	0.5	LMO7	FALSE	Q8WWI1	reviewed	LIM domain only protein 7 (LMO-7) (F-box only protein 20) (LOMP)	LMO7 FBX20 FBXO20 KIAA0858	5 out of 5	TISSUE SPECIFICITY: Widely expressed. Isoform 2 and isoform 4 are predominantly expressed in brain. {ECO:0000269|PubMed:11935316, ECO:0000269|PubMed:9826547}.	protein ubiquitination [GO:0016567]; regulation of cell adhesion [GO:0030155]; regulation of signaling [GO:0023051]	NA	NA	11935316; 15057823; 10048485; 12168954; 10531035; 9826547; 17081983; 16964243; 17924679; 18220336; 18691976; 18669648; 19690332; 20068231; 21269460; 21406692; 22814378; 23186163; 24275569; 16959974
13	108861092	nonsynonymous	G	T	0.458333333333333	1	LIG4	TRUE	P49917	reviewed	DNA ligase 4 (EC 6.5.1.1) (DNA ligase IV) (Polydeoxyribonucleotide synthase [ATP] 4)	LIG4	5 out of 5	TISSUE SPECIFICITY: Testis, thymus, prostate and heart.	cell cycle [GO:0007049]; cell division [GO:0051301]; cell proliferation [GO:0008283]; cellular response to lithium ion [GO:0071285]; central nervous system development [GO:0007417]; chromosome organization [GO:0051276]; DNA biosynthetic process [GO:0071897]; DNA ligation [GO:0006266]; DNA ligation involved in DNA recombination [GO:0051102]; DNA ligation involved in DNA repair [GO:0051103]; DNA replication [GO:0006260]; double-strand break repair [GO:0006302]; double-strand break repair via classical nonhomologous end joining [GO:0097680]; double-strand break repair via nonhomologous end joining [GO:0006303]; establishment of integrated proviral latency [GO:0075713]; immunoglobulin V(D)J recombination [GO:0033152]; in utero embryonic development [GO:0001701]; isotype switching [GO:0045190]; negative regulation of neuron apoptotic process [GO:0043524]; neuron apoptotic process [GO:0051402]; nucleotide-excision repair, DNA gap filling [GO:0006297]; positive regulation of chromosome organization [GO:2001252]; positive regulation of fibroblast proliferation [GO:0048146]; positive regulation of neurogenesis [GO:0050769]; pro-B cell differentiation [GO:0002328]; response to gamma radiation [GO:0010332]; response to X-ray [GO:0010165]; single strand break repair [GO:0000012]; somatic stem cell population maintenance [GO:0035019]; T cell differentiation in thymus [GO:0033077]; T cell receptor V(D)J recombination [GO:0033153]; V(D)J recombination [GO:0033151]	DISEASE: LIG4 syndrome (LIG4S) [MIM:606593]: Characterized by immunodeficiency and developmental and growth delay. Patients display unusual facial features, microcephaly, growth and/or developmental delay, pancytopenia, and various skin abnormalities. {ECO:0000269|PubMed:11779494}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Severe combined immunodeficiency autosomal recessive T-cell-negative/B-cell-negative/NK-cell-positive with sensitivity to ionizing radiation (RSSCID) [MIM:602450]: A form of severe combined immunodeficiency, a genetically and clinically heterogeneous group of rare congenital disorders characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients present in infancy with recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T-cell development. Individuals affected by RS-SCID show defects in the DNA repair machinery necessary for coding joint formation and the completion of V(D)J recombination. A subset of cells from such patients show increased radiosensitivity. {ECO:0000269|PubMed:16357942}. Note=The disease is caused by mutations affecting the gene represented in this entry.	235;99812;39041;	7760816; 15057823; 15489334; 8798671; 9809069; 9259561; 10854421; 12547193; 17396150; 21269460; 25941166; 25670504; 25574025; 11702069; 10395545; 11349135; 11779494; 12471202; 16357942; 25728776
13	111293895	frameshift	ATTTTTGGTC	ATTTTTTGGTC	0.56	0	CARS2	TRUE	Q9HA77	reviewed	Probable cysteine--tRNA ligase, mitochondrial (EC 6.1.1.16) (Cysteinyl-tRNA synthetase) (CysRS)	CARS2 OK/SW-cl.10	4 out of 5	NA	cysteinyl-tRNA aminoacylation [GO:0006423]	DISEASE: Combined oxidative phosphorylation deficiency 27 (COXPD27) [MIM:616672]: An autosomal recessive mitochondrial disorder characterized by multiple mitochondrial respiratory-chain-complex deficiencies causing neurological regression, progressive cognitive decline, complex movement disorder, epileptic encephalopathy, progressive spastic tetraparesis, and progressive impairment of vision and hearing. {ECO:0000269|PubMed:25361775, ECO:0000269|PubMed:25787132}. Note=The disease is caused by mutations affecting the gene represented in this entry.	NA	14702039; 15057823; 15489334; 15779907; 21269460; 25361775; 25787132; 25944712
14	21109505	nonsynonymous	G	T	0.409090909090909	0.5	OR6S1	TRUE	Q8NH40	reviewed	Olfactory receptor 6S1 (Olfactory receptor OR14-37)	OR6S1	3 out of 5	NA	NA	NA	NA	14983052
14	22133849	nonsynonymous	A	G	0.464285714285714	0	OR4E2	TRUE	Q8NGC2	reviewed	Olfactory receptor 4E2 (Olfactory receptor OR14-42)	OR4E2	3 out of 5	NA	detection of chemical stimulus involved in sensory perception [GO:0050907]; G-protein coupled receptor signaling pathway [GO:0007186]	NA	NA	12213199; 14983052
14	24435564	nonsynonymous	C	T	0.4	0	DHRS4	TRUE	Q9BTZ2	reviewed	Dehydrogenase/reductase SDR family member 4 (EC 1.1.1.184) (NADPH-dependent carbonyl reductase/NADP-retinol dehydrogenase) (CR) (PHCR) (NADPH-dependent retinol dehydrogenase/reductase) (NRDR) (humNRDR) (Peroxisomal short-chain alcohol dehydrogenase) (PSCD) (SCAD-SRL) (Short chain dehydrogenase/reductase family 25C member 2) (Short-chain dehydrogenase/reductase family member 4)	DHRS4 SDR25C2 UNQ851/PRO1800	5 out of 5	TISSUE SPECIFICITY: Isoform 1 is predominantly expressed in normal cervix (at protein level). Isoform 4 is expressed in some neoplastic cervical tissues, but not in normal cervix (at protein level). Isoform 5 and isoform 6 are expressed in a few neoplastic cervical tissues.	alcohol metabolic process [GO:0006066]; cellular ketone metabolic process [GO:0042180]; oxidation-reduction process [GO:0055114]; protein tetramerization [GO:0051262]; steroid metabolic process [GO:0008202]	NA	NA	10333503; 15473316; 17230527; 14702039; 12975309; 12508121; 15489334; 18669648; 21269460; 23128527; 22227495; 24275569; 25944712
14	45403616	nonsynonymous	T	C	0.6	1	KLHL28	TRUE	Q9NXS3	reviewed	Kelch-like protein 28 (BTB/POZ domain-containing protein 5)	KLHL28 BTBD5	2 out of 5	NA	protein ubiquitination involved in ubiquitin-dependent protein catabolic process [GO:0042787]	NA	NA	14702039; 15489334
14	65262126	nonsynonymous	C	T	0.25	1	SPTB	TRUE	P11277	reviewed	Spectrin beta chain, erythrocytic (Beta-I spectrin)	SPTB SPTB1	5 out of 5	NA	actin filament capping [GO:0051693]; axon guidance [GO:0007411]; ER to Golgi vesicle-mediated transport [GO:0006888]; MAPK cascade [GO:0000165]	DISEASE: Elliptocytosis 3 (EL3) [MIM:182870]: A Rhesus-unlinked form of hereditary elliptocytosis, a genetically heterogeneous, autosomal dominant hematologic disorder. It is characterized by variable hemolytic anemia and elliptical or oval red cell shape. {ECO:0000269|PubMed:1975598, ECO:0000269|PubMed:7883966, ECO:0000269|PubMed:8018926, ECO:0000269|PubMed:8226774}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Spherocytosis 2 (SPH2) [MIM:616649]: An autosomal dominant form of hereditary spherocytosis, a group of hematologic disorders characterized by numerous abnormally shaped erythrocytes which are generally spheroidal. Clinical manifestations include chronic hemolytic anemia, jaundice, and splenomegaly, with variable severity. {ECO:0000269|PubMed:19538529, ECO:0000269|PubMed:8102379}. Note=The disease is caused by mutations affecting the gene represented in this entry.	288;822;	2195026; 12508121; 2056132; 2243099; 1840591; 1976574; 3390609; 3478706; 12665801; 6472478; 15065869; 19538529; 21269460; 23186163; 24275569; 15062087; 8844207; 8226774; 8102379; 7883966; 8018926; 1975598
14	75514489	nonsynonymous	C	G	0.708333333333333	0.5	MLH3	TRUE	Q9UHC1	reviewed	DNA mismatch repair protein Mlh3 (MutL protein homolog 3)	MLH3	5 out of 5	TISSUE SPECIFICITY: Ubiquitous.	female meiosis I [GO:0007144]; male meiosis [GO:0007140]; mismatch repair [GO:0006298]; protein localization [GO:0008104]; reciprocal meiotic recombination [GO:0007131]; synaptonemal complex assembly [GO:0007130]	DISEASE: Hereditary non-polyposis colorectal cancer 7 (HNPCC7) [MIM:614385]: An autosomal dominant disease associated with marked increase in cancer susceptibility. It is characterized by a familial predisposition to early-onset colorectal carcinoma (CRC) and extra-colonic tumors of the gastrointestinal, urological and female reproductive tracts. HNPCC is reported to be the most common form of inherited colorectal cancer in the Western world. Clinically, HNPCC is often divided into two subgroups. Type I is characterized by hereditary predisposition to colorectal cancer, a young age of onset, and carcinoma observed in the proximal colon. Type II is characterized by increased risk for cancers in certain tissues such as the uterus, ovary, breast, stomach, small intestine, skin, and larynx in addition to the colon. Diagnosis of classical HNPCC is based on the Amsterdam criteria: 3 or more relatives affected by colorectal cancer, one a first degree relative of the other two; 2 or more generation affected; 1 or more colorectal cancers presenting before 50 years of age; exclusion of hereditary polyposis syndromes. The term 'suspected HNPCC' or 'incomplete HNPCC' can be used to describe families who do not or only partially fulfill the Amsterdam criteria, but in whom a genetic basis for colon cancer is strongly suspected. {ECO:0000269|PubMed:11586295}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Colorectal cancer (CRC) [MIM:114500]: A complex disease characterized by malignant lesions arising from the inner wall of the large intestine (the colon) and the rectum. Genetic alterations are often associated with progression from premalignant lesion (adenoma) to invasive adenocarcinoma. Risk factors for cancer of the colon and rectum include colon polyps, long-standing ulcerative colitis, and genetic family history. {ECO:0000269|PubMed:11317354}. Note=The disease is caused by mutations affecting the gene represented in this entry.	144;	10615123; 11292842; 12508121; 7596406; 11317354; 20603073; 11586295
14	95236204	nonsynonymous	GCGCCGCCGCT	GCGCCGCCGCCGCT	0.583333333333333	1	GSC	TRUE	P56915	reviewed	Homeobox protein goosecoid	GSC	4 out of 5	NA	dorsal/ventral neural tube patterning [GO:0021904]; embryonic skeletal system morphogenesis [GO:0048704]; forebrain development [GO:0030900]; gastrulation [GO:0007369]; middle ear morphogenesis [GO:0042474]; muscle organ morphogenesis [GO:0048644]; negative regulation of transcription from RNA polymerase II promoter [GO:0000122]; negative regulation of Wnt signaling pathway [GO:0030178]; neural crest cell fate specification [GO:0014036]; signal transduction involved in regulation of gene expression [GO:0023019]	DISEASE: Short stature, auditory canal atresia, mandibular hypoplasia, skeletal abnormalities (SAMS) [MIM:602471]: An autosomal recessive developmental disorder with features of a first and second branchial arch syndrome, and with unique rhizomelic skeletal anomalies. Craniofacial abnormalities can lead to conductive hearing loss, respiratory insufficiency, and feeding difficulties. Skeletal features include bilateral humeral hypoplasia, humeroscapular synostosis, pelvic abnormalities, and proximal defects of the femora. Affected individuals may also have some features of a neurocristopathy or abnormal mesoderm development, such as urogenital anomalies, that are distinct from other branchial arch syndromes. {ECO:0000269|PubMed:24290375}. Note=The disease is caused by mutations affecting the gene represented in this entry.	397623;	7916327; 15489334; 24290375; 
14	100801331	nonsynonymous	C	T	0.52	0	WARS	TRUE	P23381	reviewed	Tryptophan--tRNA ligase, cytoplasmic (EC 6.1.1.2) (Interferon-induced protein 53) (IFP53) (Tryptophanyl-tRNA synthetase) (TrpRS) (hWRS) [Cleaved into: T1-TrpRS; T2-TrpRS]	WARS IFI53 WRS	5 out of 5	NA	angiogenesis [GO:0001525]; negative regulation of cell proliferation [GO:0008285]; regulation of angiogenesis [GO:0045765]; translation [GO:0006412]; tRNA aminoacylation for protein translation [GO:0006418]; tryptophanyl-tRNA aminoacylation [GO:0006436]	NA	NA	1761529; 1763065; 1765274; 1537332; 14702039; 12508121; 15489334; 8724762; 7685728; 8496617; 11773626; 1286667; 1373391; 7814400; 11773625; 14630953; 15628863; 18669648; 19608861; 20068231; 21269460; 22223895; 22814378; 23186163; 14671330; 14660560; 16959974
14	102900798	nonsynonymous	T	G	0.545454545454545	0.9	TECPR2	TRUE	O15040	reviewed	Tectonin beta-propeller repeat-containing protein 2 (WD repeat-containing protein KIAA0329/KIAA0297)	TECPR2 KIAA0297 KIAA0329	5 out of 5	TISSUE SPECIFICITY: Detected in skin fibroblast (at protein level). {ECO:0000269|PubMed:23176824}.	autophagy [GO:0006914]	DISEASE: Spastic paraplegia 49, autosomal recessive (SPG49) [MIM:615031]: A form of spastic paraplegia, a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. Complicated forms are recognized by additional variable features including spastic quadriparesis, seizures, dementia, amyotrophy, extrapyramidal disturbance, cerebral or cerebellar atrophy, optic atrophy, and peripheral neuropathy, as well as by extra neurological manifestations. SPG49 is characterized by delayed psychomotor development, mental retardation, and onset of spastic paraplegia in the first decade. Affected individuals also have dysmorphic features, thin corpus callosum on brain imaging, and episodes of central apnea, which may be fatal. {ECO:0000269|PubMed:23176824}. Note=The disease is caused by mutations affecting the gene represented in this entry.	320385;	9205841; 12508121; 15489334; 18669648; 20562859; 23176824
15	24922629	nonsynonymous	G	A	0.5	0	NPAP1	TRUE	Q9NZP6	reviewed	Nuclear pore-associated protein 1	NPAP1 C15orf2	5 out of 5	TISSUE SPECIFICITY: Testis-specific in adults. In fetal brain expressed only from the paternal allele. {ECO:0000269|PubMed:10783265, ECO:0000269|PubMed:17337158, ECO:0000269|PubMed:20020165}.	cell differentiation [GO:0030154]; multicellular organism development [GO:0007275]; spermatogenesis [GO:0007283]	NA	NA	10783265; 16572171; 16959974; 17337158; 20020165; 22694955
15	41105992	nonsynonymous	C	T	0.5	0	ZFYVE19	TRUE	Q96K21	reviewed	Abscission/NoCut checkpoint regulator (ANCHR) (MLL partner containing FYVE domain) (Zinc finger FYVE domain-containing protein 19)	ZFYVE19 ANCHR MPFYVE	5 out of 5	TISSUE SPECIFICITY: Detected in brain, heart, skeletal muscle, kidney and liver. {ECO:0000269|PubMed:12618766}.	abscission [GO:0009838]; cell cycle [GO:0007049]; cell division [GO:0051301]; negative regulation of cytokinesis [GO:0032466]	DISEASE: Note=A chromosomal aberration involving ZFYVE19 is associated with acute myeloblastic leukemia (AML). Translocation t(11;15)(q23;q14) with KMT2A/MLL1 (PubMed:12618766). {ECO:0000269|PubMed:12618766}.	NA	12618766; 14702039; 16572171; 15489334; 19367720; 18669648; 18318008; 19690332; 20068231; 21406692; 23186163; 24275569; 24814515; 25218447
15	41308365	nonsynonymous	A	C	0.5	1	INO80	TRUE	Q9ULG1	reviewed	DNA helicase INO80 (hINO80) (EC 3.6.4.12) (INO80 complex subunit A) (Putative DNA helicase INO80 complex homolog 1)	INO80 INO80A INOC1 KIAA1259	5 out of 5	TISSUE SPECIFICITY: According to PubMed:10574462, widely expressed. According to PubMed:16298340, specifically expressed in brain, liver and pancreas. {ECO:0000269|PubMed:10574462, ECO:0000269|PubMed:16298340}.	cell division [GO:0051301]; cellular response to ionizing radiation [GO:0071479]; cellular response to UV [GO:0034644]; chromatin remodeling [GO:0006338]; double-strand break repair [GO:0006302]; double-strand break repair via homologous recombination [GO:0000724]; mitotic sister chromatid segregation [GO:0000070]; positive regulation of cell growth [GO:0030307]; positive regulation of nuclear cell cycle DNA replication [GO:0010571]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; regulation of G1/S transition of mitotic cell cycle [GO:2000045]; spindle assembly [GO:0051225]; transcription, DNA-templated [GO:0006351]; UV-damage excision repair [GO:0070914]	NA	NA	10574462; 15489334; 17974005; 16230350; 16298340; 17721549; 18026119; 18922472; 18669648; 19690332; 19608861; 20971067; 20687897; 20237820; 20855601; 21303910
15	71952899	nonsynonymous	G	A	0.476190476190476	1	THSD4	TRUE	Q6ZMP0	reviewed	Thrombospondin type-1 domain-containing protein 4 (A disintegrin and metalloproteinase with thrombospondin motifs-like protein 6) (ADAMTS-like protein 6) (ADAMTSL-6)	THSD4 UNQ9334/PRO34005	3 out of 5	NA	elastic fiber assembly [GO:0048251]	NA	NA	12975309; 14702039; 16572171; 15489334; 17974005
15	77324817	nonsynonymous	G	A	0.266666666666667	0	PSTPIP1	FALSE	O43586	reviewed	Proline-serine-threonine phosphatase-interacting protein 1 (PEST phosphatase-interacting protein 1) (CD2-binding protein 1) (H-PIP)	PSTPIP1 CD2BP1	5 out of 5	TISSUE SPECIFICITY: Highly expressed in the peripheral blood leukocytes, granulocytes and monocytes, namely in T-cells and natural killer cells, and in spleen. Weakly expressed in the thymus, small intestine, lung and placenta. {ECO:0000269|PubMed:14595024, ECO:0000269|PubMed:9857189}.	cell adhesion [GO:0007155]; cell migration [GO:0016477]; endocytosis [GO:0006897]; inflammatory response [GO:0006954]; innate immune response [GO:0045087]; signal transduction [GO:0007165]	DISEASE: PAPA syndrome (PAPAS) [MIM:604416]: Characterized by autosomal dominant inheritance of early-onset, primarily affecting skin and joint tissues. Recurring inflammatory episodes lead to accumulation of sterile, pyogenic, neutrophil-rich material within the affected joints, ultimately resulting in significant destruction. {ECO:0000269|PubMed:11971877, ECO:0000269|PubMed:22161697}. Note=The disease is caused by mutations affecting the gene represented in this entry.	69126;	9857189; 19054851; 15489334; 14595024; 17964261; 18480402; 19807924; 19109554; 19584923; 11971877; 22161697
16	320583	nonsynonymous	C	T	0.6	0	RGS11	TRUE	O94810	reviewed	Regulator of G-protein signaling 11 (RGS11)	RGS11	4 out of 5	NA	G-protein coupled receptor signaling pathway [GO:0007186]; intracellular signal transduction [GO:0035556]; negative regulation of signal transduction [GO:0009968]; regulation of G-protein coupled receptor protein signaling pathway [GO:0008277]	NA	NA	9789084; 11157797; 15616553; 10339615
16	2139814	nonsynonymous	G	A	0.541666666666667	0.1	PKD1	TRUE	P98161	reviewed	Polycystin-1 (Autosomal dominant polycystic kidney disease 1 protein)	PKD1	5 out of 5	NA	anatomical structure morphogenesis [GO:0009653]; branching morphogenesis of an epithelial tube [GO:0048754]; calcium-independent cell-matrix adhesion [GO:0007161]; calcium ion transmembrane transport [GO:0070588]; cartilage condensation [GO:0001502]; cartilage development [GO:0051216]; cell cycle arrest [GO:0007050]; cell-matrix adhesion [GO:0007160]; cytoplasmic sequestering of transcription factor [GO:0042994]; detection of mechanical stimulus [GO:0050982]; digestive tract development [GO:0048565]; embryonic placenta development [GO:0001892]; establishment of cell polarity [GO:0030010]; genitalia development [GO:0048806]; heart development [GO:0007507]; homophilic cell adhesion via plasma membrane adhesion molecules [GO:0007156]; in utero embryonic development [GO:0001701]; JAK-STAT cascade [GO:0007259]; kidney development [GO:0001822]; liver development [GO:0001889]; lung epithelium development [GO:0060428]; lymph vessel morphogenesis [GO:0036303]; mesonephric duct development [GO:0072177]; mesonephric tubule development [GO:0072164]; metanephric ascending thin limb development [GO:0072218]; metanephric collecting duct development [GO:0072205]; metanephric distal tubule morphogenesis [GO:0072287]; metanephric proximal tubule development [GO:0072237]; neural tube development [GO:0021915]; nitrogen compound metabolic process [GO:0006807]; peptidyl-serine phosphorylation [GO:0018105]; placenta blood vessel development [GO:0060674]; positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle [GO:0031659]; positive regulation of cytosolic calcium ion concentration [GO:0007204]; positive regulation of protein binding [GO:0032092]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; protein export from nucleus [GO:0006611]; regulation of cell adhesion [GO:0030155]; regulation of mitotic spindle organization [GO:0060236]; regulation of proteasomal protein catabolic process [GO:0061136]; response to fluid shear stress [GO:0034405]; single organismal cell-cell adhesion [GO:0016337]; skin development [GO:0043588]; spinal cord development [GO:0021510]	DISEASE: Polycystic kidney disease 1 (PKD1) [MIM:173900]: A disorder characterized by renal cysts, liver cysts and intracranial aneurysm. Clinical variability is due to differences in the rate of loss of glomerular filtration, the age of reaching end-stage renal disease and the occurrence of hypertension, symptomatic extrarenal cysts, and subarachnoid hemorrhage from intracranial 'berry' aneurysm. {ECO:0000269|PubMed:10200984, ECO:0000269|PubMed:10364515, ECO:0000269|PubMed:10577909, ECO:0000269|PubMed:10647901, ECO:0000269|PubMed:10729710, ECO:0000269|PubMed:10854095, ECO:0000269|PubMed:10923040, ECO:0000269|PubMed:10987650, ECO:0000269|PubMed:11012875, ECO:0000269|PubMed:11058904, ECO:0000269|PubMed:11115377, ECO:0000269|PubMed:11216660, ECO:0000269|PubMed:11316854, ECO:0000269|PubMed:11558899, ECO:0000269|PubMed:11571556, ECO:0000269|PubMed:11691639, ECO:0000269|PubMed:11773467, ECO:0000269|PubMed:11857740, ECO:0000269|PubMed:11967008, ECO:0000269|PubMed:12007219, ECO:0000269|PubMed:12070253, ECO:0000269|PubMed:12220456, ECO:0000269|PubMed:12842373, ECO:0000269|PubMed:15772804, ECO:0000269|PubMed:18837007, ECO:0000269|PubMed:21115670, ECO:0000269|PubMed:22508176, ECO:0000269|PubMed:8554072, ECO:0000269|PubMed:9199561, ECO:0000269|PubMed:9259200, ECO:0000269|PubMed:9285784, ECO:0000269|PubMed:9521593, ECO:0000269|PubMed:9921908}. Note=The disease is caused by mutations affecting the gene represented in this entry.	730;88924;	7736581; 7663510; 15616553; 8004675; 10339594; 12482949; 17525154; 17980165; 20980620; 20856870; 24939912; 9889186; 11698076; 8554072; 9199561; 9150733; 9285784; 9259200; 9521593; 9921908; 10364515; 10577909; 10987650; 10647901; 10200984; 10854095; 11216660; 10923040; 11058904; 11012875; 10729710; 11115377; 11571556; 11316854; 11558899; 11691639; 12220456; 11857740; 12007219; 12070253; 11967008; 11773467; 12842373; 15772804; 18837007; 21115670; 22508176
16	2813952	nonsynonymous	C	G	0.424242424242424	0.1	SRRM2	TRUE	Q9UQ35	reviewed	Serine/arginine repetitive matrix protein 2 (300 kDa nuclear matrix antigen) (Serine/arginine-rich splicing factor-related nuclear matrix protein of 300 kDa) (SR-related nuclear matrix protein of 300 kDa) (Ser/Arg-related nuclear matrix protein of 300 kDa) (Splicing coactivator subunit SRm300) (Tax-responsive enhancer element-binding protein 803) (TaxREB803)	SRRM2 KIAA0324 SRL300 SRM300 HSPC075	5 out of 5	TISSUE SPECIFICITY: Expressed in liver, placenta, and white blood cells. {ECO:0000269|PubMed:11004489}.	mRNA splicing, via spliceosome [GO:0000398]	NA	NA	11004489; 10668804; 9205841; 15616553; 15489334; 9531537; 11991638; 15144186; 17081983; 16964243; 17924679; 17525332; 18220336; 18669648; 19413330; 19854871; 19690332; 19608861; 20068231; 21269460; 21406692; 22223895; 22814378; 23186163; 24275569
16	3712963	nonsynonymous	C	T	0.451612903225806	1	TRAP1	TRUE	Q12931	reviewed	Heat shock protein 75 kDa, mitochondrial (HSP 75) (TNFR-associated protein 1) (Tumor necrosis factor type 1 receptor-associated protein) (TRAP-1)	TRAP1 HSP75	5 out of 5	TISSUE SPECIFICITY: Found in skeletal muscle, liver, heart, brain, kidney, pancreas, lung, placenta and bladder. Expression is higly reduced in bladder cancer and renal cell carcinoma specimens compared to healthy tissues, but it is increased in other type of tumors. {ECO:0000269|PubMed:23564345}.	chaperone-mediated protein folding [GO:0061077]; negative regulation of cellular respiration [GO:1901856]; negative regulation of intrinsic apoptotic signaling pathway in response to hydrogen peroxide [GO:1903751]; negative regulation of reactive oxygen species biosynthetic process [GO:1903427]; response to stress [GO:0006950]; translational attenuation [GO:0009386]	NA	NA	10545594; 14702039; 15616553; 15489334; 7876093; 8756626; 10652318; 18669648; 19608861; 21269460; 23747254; 23525905; 23186163; 23564345; 24275569; 25944712
16	21139071	nonsynonymous	G	A	0.692307692307692	1	DNAH3	TRUE	Q8TD57	reviewed	Dynein heavy chain 3, axonemal (Axonemal beta dynein heavy chain 3) (HsADHC3) (Ciliary dynein heavy chain 3) (Dnahc3-b)	DNAH3 DNAHC3B	5 out of 5	TISSUE SPECIFICITY: Expressed primarily in trachea and testis, 2 tissues containing axonemal structures. Also expressed in lung. {ECO:0000269|PubMed:9256245}.	cilium or flagellum-dependent cell motility [GO:0001539]; microtubule-based movement [GO:0007018]	NA	NA	14702039; 9373155; 9256245; 15489334; 17974005; 10493829; 16959974
16	23700676	nonsynonymous	T	A	0.541666666666667	1	PLK1	TRUE	P53350	reviewed	Serine/threonine-protein kinase PLK1 (EC 2.7.11.21) (Polo-like kinase 1) (PLK-1) (Serine/threonine-protein kinase 13) (STPK13)	PLK1 PLK	5 out of 5	TISSUE SPECIFICITY: Placenta and colon.	anaphase-promoting complex-dependent catabolic process [GO:0031145]; cell proliferation [GO:0008283]; centrosome organization [GO:0051297]; cytokinesis [GO:0000910]; establishment of protein localization [GO:0045184]; female meiosis chromosome segregation [GO:0016321]; G2/M transition of mitotic cell cycle [GO:0000086]; G2 DNA damage checkpoint [GO:0031572]; homologous chromosome segregation [GO:0045143]; microtubule bundle formation [GO:0001578]; mitotic cytokinesis [GO:0000281]; mitotic nuclear division [GO:0007067]; mitotic nuclear envelope disassembly [GO:0007077]; mitotic sister chromatid segregation [GO:0000070]; mitotic spindle assembly checkpoint [GO:0007094]; negative regulation of apoptotic process [GO:0043066]; negative regulation of cyclin-dependent protein serine/threonine kinase activity [GO:0045736]; negative regulation of transcription from RNA polymerase II promoter [GO:0000122]; peptidyl-serine phosphorylation [GO:0018105]; positive regulation of peptidyl-threonine phosphorylation [GO:0010800]; positive regulation of proteasomal ubiquitin-dependent protein catabolic process [GO:0032436]; positive regulation of protein localization to nucleus [GO:1900182]; positive regulation of proteolysis [GO:0045862]; positive regulation of ubiquitin protein ligase activity [GO:1904668]; positive regulation of ubiquitin-protein ligase activity involved in regulation of mitotic cell cycle transition [GO:0051437]; positive regulation of ubiquitin-protein transferase activity [GO:0051443]; protein destabilization [GO:0031648]; protein localization to chromatin [GO:0071168]; protein phosphorylation [GO:0006468]; protein ubiquitination [GO:0016567]; protein ubiquitination involved in ubiquitin-dependent protein catabolic process [GO:0042787]; regulation of cell cycle [GO:0051726]; regulation of cell cycle G2/M phase transition [GO:1902749]; regulation of mitotic cell cycle [GO:0007346]; regulation of mitotic metaphase/anaphase transition [GO:0030071]; regulation of mitotic spindle assembly [GO:1901673]; regulation of protein binding [GO:0043393]; regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle [GO:0051439]; sister chromatid cohesion [GO:0007062]; synaptonemal complex disassembly [GO:0070194]	DISEASE: Note=Defects in PLK1 are associated with some cancers, such as gastric, thyroid or B-cell lymphomas. Expression is cancer increased in tumor tissues with a poor prognosis, suggesting a role in malignant transformations and carcinogenesis.	NA	8018557; 7902533; 7962193; 8127874; 15489334; 7478607; 9083047; 8991084; 11202906; 12207013; 12447691; 12442251; 12852856; 12639966; 12738781; 12939256; 12524548; 14734534; 15469984; 15070733; 15148369; 16198290; 15616186; 16439210; 16760428; 16980960; 16247472; 17081991; 16645325; 17981789; 17218258; 17617734; 17310276; 17376779; 17943598; 17351640; 17495026; 18662541; 18329369; 18418051; 18521620; 18331714; 18477460; 18174154; 19029337; 18691976; 19160488; 18615013; 18669648; 19596235; 19473992; 19509060; 19351716; 19369195; 19468300; 19468302; 20671765; 20068231; 21269460; 21402792; 22753416; 22814378; 23455152; 23509069; 23186163; 23455478; 25503564; 14532005; 14592974; 17461553; 18005335; 17307877; 18391401; 19597481; 17344846
16	27772821	nonsynonymous	C	T	0.583333333333333	1	KIAA0556	TRUE	O60303	reviewed	Protein KIAA0556	KIAA0556	5 out of 5	NA	NA	DISEASE: Joubert syndrome 26 (JBTS26) [MIM:616784]: A form of Joubert syndrome, a disorder presenting with cerebellar ataxia, oculomotor apraxia, hypotonia, neonatal breathing abnormalities and psychomotor delay. Neuroradiologically, it is characterized by cerebellar vermian hypoplasia/aplasia, thickened and reoriented superior cerebellar peduncles, and an abnormally large interpeduncular fossa, giving the appearance of a molar tooth on transaxial slices (molar tooth sign). Additional variable features include retinal dystrophy, renal disease, liver fibrosis, and polydactyly. JBTS26 inheritance is autosomal recessive. {ECO:0000269|PubMed:26714646}. Note=The disease is caused by mutations affecting the gene represented in this entry.	NA	9628581; 12168954; 15616553; 15489334; 18669648; 23186163; 26714646
16	30100401	nonsynonymous	C	T	0.368421052631579	1	TBX6	TRUE	O95947	reviewed	T-box transcription factor TBX6 (T-box protein 6)	TBX6	5 out of 5	TISSUE SPECIFICITY: Expressed in fetal tail bud, posterior spinal tissue, intervertebral disk and testis. Also expressed in adult testis, kidney, lung, muscle and thymus.	anatomical structure morphogenesis [GO:0009653]; cell fate specification [GO:0001708]; mesoderm development [GO:0007498]; mesoderm formation [GO:0001707]; negative regulation of neuron maturation [GO:0014043]; negative regulation of neuron projection development [GO:0010977]; negative regulation of transcription from RNA polymerase II promoter [GO:0000122]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; signal transduction involved in regulation of gene expression [GO:0023019]; somite rostral/caudal axis specification [GO:0032525]; transcription, DNA-templated [GO:0006351]	DISEASE: Spondylocostal dysostosis 5, autosomal dominant (SCDO5) [MIM:122600]: A rare condition of variable severity characterized by vertebral and costal anomalies. The main feature include dwarfism, vertebral fusion, hemivertebrae, posterior rib fusion, reduced rib number, and other rib malformations. {ECO:0000269|PubMed:23335591}. Note=The disease is caused by mutations affecting the gene represented in this entry.	1797;247775;2578;	9933572; 14702039; 15616553; 15489334; 9888994; 23335591
16	58537777	nonsynonymous	A	G	0.631578947368421	1	NDRG4	TRUE	Q9ULP0	reviewed	Protein NDRG4 (Brain development-related molecule 1) (N-myc downstream-regulated gene 4 protein) (Vascular smooth muscle cell-associated protein 8) (SMAP-8)	NDRG4 BDM1 KIAA1180	5 out of 5	TISSUE SPECIFICITY: Expressed predominantly in brain and heart (at protein level). In the brain, detected in astrocytes. Isoform 1 and isoform 2 are only expressed in brain. Isoform 3 is expressed in both heart and brain. Up-regulated in glioblastoma multiforme cells. {ECO:0000269|PubMed:11352569, ECO:0000269|PubMed:12755708, ECO:0000269|PubMed:19592488}.	brain development [GO:0007420]; cardiac muscle cell proliferation [GO:0060038]; cell differentiation [GO:0030154]; cell growth [GO:0016049]; cell migration involved in heart development [GO:0060973]; embryonic heart tube development [GO:0035050]; heart looping [GO:0001947]; negative regulation of platelet-derived growth factor receptor signaling pathway [GO:0010642]; negative regulation of smooth muscle cell migration [GO:0014912]; negative regulation of smooth muscle cell proliferation [GO:0048662]; positive regulation of ERK1 and ERK2 cascade [GO:0070374]; positive regulation of neuron projection development [GO:0010976]; regulation of endocytic recycling [GO:2001135]; response to stress [GO:0006950]; vesicle docking [GO:0048278]; visual learning [GO:0008542]	NA	NA	11352569; 11936845; 12755708; 11230166; 14702039; 15616553; 15489334; 10574461; 12168954; 19592488
16	67144115	nonsynonymous	G	A	0.571428571428571	1	C16orf70	TRUE	Q9BSU1	reviewed	UPF0183 protein C16orf70	C16orf70 C16orf6	2 out of 5	NA	NA	NA	NA	14702039; 15489334; 22814378; 23186163
16	70500875	nonsynonymous	T	C	0.470588235294118	0	FUK	FALSE	Q8N0W3	reviewed	L-fucose kinase (Fucokinase) (EC 2.7.1.52)	FUK	4 out of 5	NA	NA	NA	NA	12056818; 14702039; 15489334
16	70698094	nonsynonymous	G	A	0.55	0.8	MTSS1L	TRUE	Q765P7	reviewed	MTSS1-like protein (Actin-bundling with BAIAP2 homology protein 1) (ABBA-1)	MTSS1L	3 out of 5	NA	plasma membrane organization [GO:0007009]	NA	NA	14752106; 15616553; 15489334; 18220336; 18669648; 19413330; 19690332; 20068231; 23186163; 24275569
16	75276547	nonsynonymous	T	C	0.578947368421053	0.4	BCAR1	TRUE	P56945	reviewed	Breast cancer anti-estrogen resistance protein 1 (CRK-associated substrate) (Cas scaffolding protein family member 1) (p130cas)	BCAR1 CAS CASS1 CRKAS	5 out of 5	TISSUE SPECIFICITY: Widely expressed with an abundant expression in the testis. Low level of expression seen in the liver, thymus, and peripheral blood leukocytes. The protein has been detected in a B-cell line.	actin filament organization [GO:0007015]; antigen receptor-mediated signaling pathway [GO:0050851]; B cell receptor signaling pathway [GO:0050853]; cell adhesion [GO:0007155]; cell chemotaxis [GO:0060326]; cell division [GO:0051301]; cell migration [GO:0016477]; cell proliferation [GO:0008283]; cellular response to hepatocyte growth factor stimulus [GO:0035729]; epidermal growth factor receptor signaling pathway [GO:0007173]; G-protein coupled receptor signaling pathway [GO:0007186]; hepatocyte growth factor receptor signaling pathway [GO:0048012]; insulin receptor signaling pathway [GO:0008286]; integrin-mediated signaling pathway [GO:0007229]; neurotrophin TRK receptor signaling pathway [GO:0048011]; platelet-derived growth factor receptor signaling pathway [GO:0048008]; positive regulation of cell migration [GO:0030335]; positive regulation of endothelial cell migration [GO:0010595]; regulation of apoptotic process [GO:0042981]; regulation of cell growth [GO:0001558]; T cell receptor signaling pathway [GO:0050852]; vascular endothelial growth factor receptor signaling pathway [GO:0048010]	NA	NA	10639512; 14702039; 15616553; 10587647; 11158326; 12832404; 17038317; 18669648; 19454314; 19086031; 19147981; 20534451; 20068231; 21406692; 23186163; 22710723; 15784259; 22081014; 16959974
16	87925430	nonsynonymous	T	C	0.5	0.3	CA5A	TRUE	P35218	reviewed	Carbonic anhydrase 5A, mitochondrial (EC 4.2.1.1) (Carbonate dehydratase VA) (Carbonic anhydrase VA) (CA-VA)	CA5A CA5	5 out of 5	NA	bicarbonate transport [GO:0015701]; one-carbon metabolic process [GO:0006730]	DISEASE: Hyperammonemia due to carbonic anhydrase VA deficiency (CA5AD) [MIM:615751]: An autosomal recessive inborn error of metabolism, clinically characterized by infantile hyperammonemic encephalopathy. Metabolic abnormalities include hypoglycemia, hyperlactatemia, metabolic acidosis and respiratory alkalosis. {ECO:0000269|PubMed:24530203}. Note=The disease is caused by mutations affecting the gene represented in this entry.	401948;	8356065; 7490083; 15489334; 16807956; 16686544; 17127057; 17314045; 19186056; 19206230; 18618712; 24275569; 24530203
16	88504239	nonsynonymous	G	A	0.44	0.4	ZNF469	TRUE	Q96JG9	reviewed	Zinc finger protein 469	ZNF469 KIAA1858	4 out of 5	TISSUE SPECIFICITY: Detected in cornea, sclera, skin fibroblasts and striated muscle. {ECO:0000269|PubMed:18452888}.	regulation of transcription, DNA-templated [GO:0006355]; transcription, DNA-templated [GO:0006351]	DISEASE: Brittle cornea syndrome 1 (BCS1) [MIM:229200]: A disorder characterized by extreme corneal thinning resulting in corneal rupture after minor trauma, blue sclerae, keratoconus or keratoglobus, hyperelasticity of the skin, and hypermobility of the joints. It shares some features with, but is much less severe than, the ocular form of Ehlers-Danlos syndrome (EDS6). {ECO:0000269|PubMed:18452888}. Note=The disease is caused by mutations affecting the gene represented in this entry.	90354;	15616553; 11347906; 18452888
17	722689	nonsynonymous	G	A	0.476190476190476	0.2	NXN	TRUE	Q6DKJ4	reviewed	Nucleoredoxin (EC 1.8.1.8)	NXN NRX	4 out of 5	NA	cardiovascular system development [GO:0072358]; cell differentiation [GO:0030154]; negative regulation of protein ubiquitination [GO:0031397]; negative regulation of Wnt signaling pathway [GO:0030178]; Wnt signaling pathway [GO:0016055]	NA	NA	14702039; 16625196; 15489334; 16764867; 19413330; 21269460
17	6665217	nonsynonymous	A	T	0.272727272727273	0	XAF1	FALSE	Q6GPH4	reviewed	XIAP-associated factor 1 (BIRC4-binding protein)	XAF1 BIRC4BP XIAPAF1	5 out of 5	TISSUE SPECIFICITY: Widely expressed. Expression is frequently down-regulated in cancer cell lines. Isoform 5 is widely expressed. Expressed in placenta (at protein level). {ECO:0000269|PubMed:11175744, ECO:0000269|PubMed:16343440, ECO:0000269|PubMed:17329253, ECO:0000269|PubMed:17570219}.	apoptotic process [GO:0006915]; negative regulation of protein complex assembly [GO:0031333]; response to interferon-beta [GO:0035456]; type I interferon signaling pathway [GO:0060337]	NA	NA	11175744; 17570219; 14702039; 15489334; 17974005; 12029096; 16343440; 16432762; 17613533; 17329253; 23645206
17	7697645	nonsynonymous	G	A	0.521739130434783	1	DNAH2	TRUE	Q9P225	reviewed	Dynein heavy chain 2, axonemal (Axonemal beta dynein heavy chain 2) (Ciliary dynein heavy chain 2) (Dynein heavy chain domain-containing protein 3)	DNAH2 DNAHC2 DNHD3 KIAA1503	5 out of 5	TISSUE SPECIFICITY: Expressed primarily in trachea and testis, 2 tissues containing axonemal structures. Also expressed in lung. {ECO:0000269|PubMed:9256245}.	cilium or flagellum-dependent cell motility [GO:0001539]; microtubule-based movement [GO:0007018]	NA	NA	10819331; 14702039; 16625196; 15489334; 9256245; 20835228
17	17700037	nonsynonymous	AAGGAGGAGAGGC	AAGGAGAGGC	0.555555555555556	1	RAI1	TRUE	Q7Z5J4	reviewed	Retinoic acid-induced protein 1	RAI1 KIAA1820	5 out of 5	TISSUE SPECIFICITY: Expressed in all tissues examined with higher expression in the heart and brain. No expression was seen in the corpus callosum of the brain. {ECO:0000269|PubMed:12837267}.	circadian regulation of gene expression [GO:0032922]; negative regulation of multicellular organism growth [GO:0040015]; positive regulation of transcription, DNA-templated [GO:0045893]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; skeletal system development [GO:0001501]	DISEASE: Smith-Magenis syndrome (SMS) [MIM:182290]: Characterized by congenital mental retardation associated with development and growth delays. Affected persons have characteristic behavioral abnormalities, including self-injurious behaviors and sleep disturbance, and distinct craniofacial and skeletal anomalies. {ECO:0000269|PubMed:11404004, ECO:0000269|PubMed:12652298}. Note=The disease is caused by mutations affecting the gene represented in this entry.	1713;819;	11404004; 12837267; 11347906; 15489334; 17974005; 12652298; 10915763; 18220336; 18669648; 19413330; 19690332; 20068231; 22578325; 23186163; 25114211
17	28778817	nonsynonymous	T	C	0.56	0	CPD	TRUE	O75976	reviewed	Carboxypeptidase D (EC 3.4.17.22) (Metallocarboxypeptidase D) (gp180)	CPD	5 out of 5	TISSUE SPECIFICITY: Highly expressed in placenta, pancreas and hepatoma cells. Lower levels found in skeletal muscle, heart and colon carcinoma and melanoma cell lines.	peptide metabolic process [GO:0006518]; protein processing [GO:0016485]	NA	NA	9714835; 9355738; 14702039; 16625196; 15489334; 9064476; 12643288; 12754519; 18669648; 19159218; 19690332; 21269460; 21406692; 23186163; 24275569; 25944712
17	36875827	nonsynonymous	T	C	0.451612903225806	1	MLLT6	TRUE	P55198	reviewed	Protein AF-17 (ALL1-fused gene from chromosome 17 protein)	MLLT6 AF17	4 out of 5	NA	regulation of transcription, DNA-templated [GO:0006355]	DISEASE: Note=A chromosomal aberration involving MLLT6 is associated with acute leukemias. Translocation t(11;17)(q23;q21) with KMT2A/MLL1. The result is a rogue activator protein.	NA	8058765; 16625196; 14702039; 15489334; 17974005; 19690332; 23186163
17	39593722	nonsynonymous	C	T	0.368421052631579	0.1	KRT38	TRUE	O76015	reviewed	Keratin, type I cuticular Ha8 (Hair keratin, type I Ha8) (Keratin-38) (K38)	KRT38 HHA8 HKA8 KRTHA8	5 out of 5	NA	NA	NA	NA	9756910; 16625196; 15489334; 15617563
17	48913390	nonsynonymous	G	A	0.347826086956522	0	WFIKKN2	TRUE	Q8TEU8	reviewed	WAP, Kazal, immunoglobulin, Kunitz and NTR domain-containing protein 2 (Growth and differentiation factor-associated serum protein 1) (GASP-1) (hGASP-1) (WAP, follistatin, immunoglobulin, Kunitz and NTR domain-containing-related protein) (WFIKKN-related protein)	WFIKKN2 GASP1 WFIKKNRP UNQ9235/PRO31996	4 out of 5	TISSUE SPECIFICITY: Primarily expressed in ovary, testis and brain, but not in liver. In fetal tissues, it is primarily expressed in brain, skeletal muscle, thymus and kidney. {ECO:0000269|PubMed:11928817}.	muscle fiber development [GO:0048747]; negative regulation of DNA binding [GO:0043392]; negative regulation of protein binding [GO:0032091]; palate development [GO:0060021]; skeletal system development [GO:0001501]; transforming growth factor beta receptor signaling pathway [GO:0007179]	NA	NA	11928817; 12975309; 12595574
17	61949947	nonsynonymous	G	A	0.32	1	CSH2	TRUE	P0DML3	reviewed	Chorionic somatomammotropin hormone 2 (Choriomammotropin) (Lactogen) (Placental lactogen) (PL)	CSH2	5 out of 5	NA	NA	NA	NA	3030680; 6300056; 2744760; 7169009; 18473352; 15489334; 593368; 4712450; 5286363; 438159; 16546209
17	61987944	nonsynonymous	C	A	0.578947368421053	0	CSHL1	FALSE	Q14406	reviewed	Chorionic somatomammotropin hormone-like 1 (Chorionic somatomammotropin-like) (Lactogen-like)	CSHL1 CSHP1 CSL	4 out of 5	NA	NA	NA	NA	2744760; 8083227; 16625196; 15489334
17	62892873	nonsynonymous	T	C	0.245283018867925	0	LRRC37A3	TRUE	O60309	reviewed	Leucine-rich repeat-containing protein 37A3	LRRC37A3 KIAA0563	3 out of 5	NA	NA	NA	NA	9628581; 15489334; 14702039
17	67151207	nonsynonymous	C	A	0.615384615384615	0	ABCA10	TRUE	Q8WWZ4	reviewed	ATP-binding cassette sub-family A member 10	ABCA10	4 out of 5	TISSUE SPECIFICITY: Widely expressed. Highly expressed in skeletal muscle, heart, brain and gastrointestinal tract. {ECO:0000269|PubMed:12821155, ECO:0000269|Ref.1}.	lipid transport [GO:0006869]	NA	NA	12821155; 17974005; 16625196; 15489334
17	74381682	nonsynonymous	C	T	0.590909090909091	0	SPHK1	TRUE	Q9NYA1	reviewed	Sphingosine kinase 1 (SK 1) (SPK 1) (EC 2.7.1.91)	SPHK1 SPHK SPK	5 out of 5	TISSUE SPECIFICITY: Widely expressed with highest levels in adult liver, kidney, heart and skeletal muscle. {ECO:0000269|PubMed:10802064}.	blood vessel development [GO:0001568]; brain development [GO:0007420]; calcium-mediated signaling [GO:0019722]; cellular response to growth factor stimulus [GO:0071363]; cellular response to hydrogen peroxide [GO:0070301]; cellular response to starvation [GO:0009267]; cyclooxygenase pathway [GO:0019371]; female pregnancy [GO:0007565]; inflammatory response [GO:0006954]; intracellular signal transduction [GO:0035556]; negative regulation of apoptotic process [GO:0043066]; positive regulation of angiogenesis [GO:0045766]; positive regulation of cell growth [GO:0030307]; positive regulation of cell migration [GO:0030335]; positive regulation of fibroblast proliferation [GO:0048146]; positive regulation of mitotic cell cycle [GO:0045931]; positive regulation of neuron projection development [GO:0010976]; positive regulation of neurotransmitter secretion [GO:0001956]; positive regulation of NF-kappaB import into nucleus [GO:0042346]; positive regulation of NF-kappaB transcription factor activity [GO:0051092]; positive regulation of peptidyl-threonine phosphorylation [GO:0010800]; positive regulation of protein ubiquitination [GO:0031398]; positive regulation of smooth muscle contraction [GO:0045987]; protein folding [GO:0006457]; regulation of interleukin-1 beta production [GO:0032651]; regulation of tumor necrosis factor-mediated signaling pathway [GO:0010803]; response to amine [GO:0014075]; response to ATP [GO:0033198]; response to interleukin-1 [GO:0070555]; response to magnesium ion [GO:0032026]; response to progesterone [GO:0032570]; signal transduction [GO:0007165]; sphingoid catabolic process [GO:0046521]; sphingolipid biosynthetic process [GO:0030148]; sphingosine biosynthetic process [GO:0046512]; sphingosine metabolic process [GO:0006670]	NA	NA	10863092; 10802064; 10947957; 14702039; 16625196; 15489334; 12080051; 14575709; 18669648; 19854831; 20577214; 23602659
17	76374763	nonsynonymous	C	T	0.541666666666667	1	PGS1	TRUE	Q32NB8	reviewed	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase, mitochondrial (EC 2.7.8.5) (Phosphatidylglycerophosphate synthase 1) (PGP synthase 1)	PGS1	5 out of 5	NA	cardiolipin biosynthetic process [GO:0032049]; diacylglycerol metabolic process [GO:0046339]; phosphatidylglycerol biosynthetic process [GO:0006655]	NA	NA	14702039; 15489334; 17974005
17	77769120	nonsynonymous	GATCCCGCTCCCGGTCCCTA	GA	0.55	0.1	CBX8	TRUE	Q9HC52	reviewed	Chromobox protein homolog 8 (Polycomb 3 homolog) (Pc3) (hPc3) (Rectachrome 1)	CBX8 PC3 RC1	5 out of 5	NA	cellular response to hydrogen peroxide [GO:0070301]; histone ubiquitination [GO:0016574]; negative regulation of transcription from RNA polymerase II promoter [GO:0000122]; positive regulation of cell proliferation [GO:0008284]; positive regulation of collagen biosynthetic process [GO:0032967]; positive regulation of DNA repair [GO:0045739]; protein sumoylation [GO:0016925]; transcription, DNA-templated [GO:0006351]	NA	NA	10825164; 14702039; 15489334; 11313972; 12167701; 18691976; 18669648; 19636380; 19690332; 20068231; 21269460; 21282530; 23186163; 24275569; 21047797
17	78357600	nonsynonymous	A	G	0.5	0	RNF213	TRUE	Q63HN8	reviewed	E3 ubiquitin-protein ligase RNF213 (EC 3.6.4.-) (EC 6.3.2.-) (ALK lymphoma oligomerization partner on chromosome 17) (Mysterin) (RING finger protein 213)	RNF213 ALO17 C17orf27 KIAA1554 KIAA1618 MYSTR	5 out of 5	TISSUE SPECIFICITY: Widely expressed (at protein level). {ECO:0000269|PubMed:21799892}.	angiogenesis [GO:0001525]; negative regulation of non-canonical Wnt signaling pathway [GO:2000051]; protein autoubiquitination [GO:0051865]; protein homooligomerization [GO:0051260]; protein polyubiquitination [GO:0000209]; protein ubiquitination [GO:0016567]; sprouting angiogenesis [GO:0002040]; ubiquitin-dependent protein catabolic process [GO:0006511]	DISEASE: Moyamoya disease 2 (MYMY2) [MIM:607151]: A progressive cerebral angiopathy characterized by bilateral intracranial carotid artery stenosis and telangiectatic vessels in the region of the basal ganglia. The abnormal vessels resemble a 'puff of smoke' (moyamoya) on cerebral angiogram. Affected individuals can develop transient ischemic attacks and/or cerebral infarction, and rupture of the collateral vessels can cause intracranial hemorrhage. Hemiplegia of sudden onset and epileptic seizures constitute the prevailing presentation in childhood, while subarachnoid bleeding occurs more frequently in adults. {ECO:0000269|PubMed:21048783, ECO:0000269|PubMed:21799892, ECO:0000269|PubMed:23110205, ECO:0000269|PubMed:23994138, ECO:0000269|PubMed:25278557, ECO:0000269|PubMed:25956231, ECO:0000269|PubMed:26126547, ECO:0000269|PubMed:26198278}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.; DISEASE: Note=A chromosomal aberration involving RNF213 is associated with anaplastic large-cell lymphoma (ALCL). Translocation t(2;17)(p23;q25) with ALK. {ECO:0000269|PubMed:12112524}.	2573;	21799892; 17974005; 16625196; 15489334; 12112524; 10997877; 14702039; 18691976; 18669648; 18318008; 19369195; 19690332; 20068231; 21269460; 21406692; 23186163; 24275569; 25218447; 24658080; 26070522; 26278786; 26766444; 21048783; 23110205; 23994138; 25043520; 25278557; 26198278; 26126547; 25956231
17	78357600	nonsynonymous	A	G	0.5	0	LOC100294362	FALSE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
18	21705440	nonsynonymous	C	T	0.392857142857143	1	TTC39C	TRUE	Q8N584	reviewed	Tetratricopeptide repeat protein 39C (TPR repeat protein 39C)	TTC39C C18orf17	2 out of 5	NA	NA	NA	NA	14702039; 16177791; 15489334
18	33243613	nonsynonymous	C	T	0.583333333333333	1	GALNT1	TRUE	Q10472	reviewed	Polypeptide N-acetylgalactosaminyltransferase 1 (EC 2.4.1.41) (Polypeptide GalNAc transferase 1) (GalNAc-T1) (pp-GaNTase 1) (Protein-UDP acetylgalactosaminyltransferase 1) (UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 1) [Cleaved into: Polypeptide N-acetylgalactosaminyltransferase 1 soluble form]	GALNT1	5 out of 5	TISSUE SPECIFICITY: Widely expressed. Expressed in all tissues tested. {ECO:0000269|PubMed:7592619}.	O-glycan processing [GO:0016266]; protein O-linked glycosylation [GO:0006493]; protein O-linked glycosylation via serine [GO:0018242]; protein O-linked glycosylation via threonine [GO:0018243]	NA	NA	8690719; 7592619; 15489334; 8727794; 9295285; 9394011; 21269460
18	33751035	frameshift	TGT	TT	0.541666666666667	1	ELP2	TRUE	Q6IA86	reviewed	Elongator complex protein 2 (ELP2) (SHINC-2) (STAT3-interacting protein 1) (StIP1)	ELP2 STATIP1	5 out of 5	NA	regulation of JAK-STAT cascade [GO:0046425]; regulation of transcription from RNA polymerase II promoter [GO:0006357]; transcription elongation from RNA polymerase II promoter [GO:0006368]	NA	NA	14702039; 16177791; 15489334; 11714725; 11818576; 22854966
18	76754444	nonsynonymous	C	T	0.541666666666667	0	SALL3	TRUE	Q9BXA9	reviewed	Sal-like protein 3 (Zinc finger protein 796) (Zinc finger protein SALL3) (hSALL3)	SALL3 ZNF796	5 out of 5	TISSUE SPECIFICITY: Widely expressed in adult with highest levels in heart. Expressed in fetal brain (in neurons of hippocampus, cortex, mediodorsal and ventrolateral thalamic nuclei, putamen, cerebellum and brainstem).	forelimb morphogenesis [GO:0035136]; hindlimb morphogenesis [GO:0035137]; negative regulation of smoothened signaling pathway [GO:0045879]; neurogenesis [GO:0022008]; olfactory bulb interneuron development [GO:0021891]; regulation of transcription, DNA-templated [GO:0006355]; signal transduction [GO:0007165]; transcription from RNA polymerase II promoter [GO:0006366]	NA	NA	10610715; 16177791; 21406692; 16959974
18	77211081	nonsynonymous	G	A	0.590909090909091	1	NFATC1	TRUE	O95644	reviewed	Nuclear factor of activated T-cells, cytoplasmic 1 (NF-ATc1) (NFATc1) (NFAT transcription complex cytosolic component) (NF-ATc) (NFATc)	NFATC1 NFAT2 NFATC	5 out of 5	TISSUE SPECIFICITY: Expressed in thymus, peripheral leukocytes as T-cells and spleen. Isoforms A are preferentially expressed in effector T-cells (thymus and peripheral leukocytes) whereas isoforms B and isoforms C are preferentially expressed in naive T-cells (spleen). Isoforms B are expressed in naive T-cells after first antigen exposure and isoforms A are expressed in effector T-cells after second antigen exposure. Isoforms IA are widely expressed but not detected in liver nor pancreas, neural expression is strongest in corpus callosum. Isoforms IB are expressed mostly in muscle, cerebellum, placenta and thymus, neural expression in fetal and adult brain, strongest in corpus callosum. {ECO:0000269|PubMed:18675896}.	calcineurin-NFAT signaling cascade [GO:0033173]; Fc-epsilon receptor signaling pathway [GO:0038095]; intracellular signal transduction [GO:0035556]; negative regulation of Wnt signaling pathway [GO:0030178]; positive regulation of transcription, DNA-templated [GO:0045893]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; transcription from RNA polymerase II promoter [GO:0006366]; Wnt signaling pathway, calcium modulating pathway [GO:0007223]	NA	NA	8202141; 8702849; 10072078; 18675896; 16177791; 15489334; 9111316; 9072970; 10089876; 10358178; 10652349; 12351631; 16511445; 23186163; 8990122; 9506523; 16959974
19	3546264	nonsynonymous	C	T	0.458333333333333	1	MFSD12	TRUE	Q6NUT3	reviewed	Major facilitator superfamily domain-containing protein 12	MFSD12 C19orf28	3 out of 5	NA	transport [GO:0006810]	NA	NA	15057824; 15489334; 22814378
19	3612817	nonsynonymous	C	G	0.607142857142857	0	CACTIN-AS1	TRUE	Q8N1I8	reviewed	Putative uncharacterized protein encoded by CACTIN-AS1 (Cactin antisense RNA 1)	CACTIN-AS1 C19orf29-AS1 C19orf29OS	1 out of 5	NA	NA	NA	NA	14702039
19	3612817	nonsynonymous	C	G	0.607142857142857	0	CACTIN	FALSE	Q8WUQ7	reviewed	Cactin (Renal carcinoma antigen NY-REN-24)	CACTIN C19orf29	5 out of 5	NA	cellular response to interleukin-1 [GO:0071347]; cellular response to lipopolysaccharide [GO:0071222]; cellular response to tumor necrosis factor [GO:0071356]; innate immune response [GO:0045087]; mRNA splicing, via spliceosome [GO:0000398]; multicellular organism development [GO:0007275]; negative regulation of interferon-beta production [GO:0032688]; negative regulation of interleukin-8 production [GO:0032717]; negative regulation of lipopolysaccharide-mediated signaling pathway [GO:0031665]; negative regulation of NF-kappaB transcription factor activity [GO:0032088]; negative regulation of protein phosphorylation [GO:0001933]; negative regulation of toll-like receptor signaling pathway [GO:0034122]; negative regulation of tumor necrosis factor production [GO:0032720]; negative regulation of type I interferon-mediated signaling pathway [GO:0060339]	NA	NA	15057824; 15489334; 10508479; 11991638; 20829348; 23186163; 24275569
19	9868686	nonsynonymous	T	A	0.393939393939394	1	ZNF846	TRUE	Q147U1	reviewed	Zinc finger protein 846	ZNF846	3 out of 5	NA	regulation of transcription, DNA-templated [GO:0006355]; transcription, DNA-templated [GO:0006351]	NA	NA	14702039; 15057824; 15489334; 18669648
19	11446144	nonsynonymous	G	A	0.269230769230769	0.6	RAB3D	TRUE	O95716	reviewed	Ras-related protein Rab-3D	RAB3D GOV RAB16	5 out of 5	TISSUE SPECIFICITY: Highly expressed in granulocytes of peripheral blood. Constitutively expressed at low levels in all hematopoietic cell lines investigated.	bone resorption [GO:0045453]; exocytosis [GO:0006887]; peptidyl-cysteine methylation [GO:0018125]; positive regulation of regulated secretory pathway [GO:1903307]; protein transport [GO:0015031]; small GTPase mediated signal transduction [GO:0007264]	NA	NA	10023084; 15489334; 21269460; 22814378; 
19	33616077	nonsynonymous	C	T	0.5625	0.9	GPATCH1	TRUE	Q9BRR8	reviewed	G patch domain-containing protein 1 (Evolutionarily conserved G-patch domain-containing protein)	GPATCH1 ECGP GPATC1	3 out of 5	NA	mRNA splicing, via spliceosome [GO:0000398]	NA	NA	15489334; 17974005; 14702039; 17081983; 20068231; 21406692; 23186163
19	37619845	nonsynonymous	C	T	0.388888888888889	0	ZNF420	TRUE	Q8TAQ5	reviewed	Zinc finger protein 420	ZNF420	4 out of 5	NA	regulation of apoptotic process [GO:0042981]; regulation of transcription, DNA-templated [GO:0006355]; transcription, DNA-templated [GO:0006351]	NA	NA	14702039; 15057824; 15489334
19	40433583	nonsynonymous	G	A	0.363636363636364	0.1	FCGBP	TRUE	Q9Y6R7	reviewed	IgGFc-binding protein (Fcgamma-binding protein antigen) (FcgammaBP)	FCGBP	5 out of 5	TISSUE SPECIFICITY: Mainly expressed in placenta and colon epithelium. Expressed in thyroid, and down-regulated in thyroid carcinomas. Present in serum, with higher levels in patients with various autoimmune diseases (at protein level). {ECO:0000269|PubMed:11600203, ECO:0000269|PubMed:12208673, ECO:0000269|PubMed:9182547}.	NA	NA	NA	9182547; 15057824; 11600203; 12208673; 15084671; 16335952; 16740002; 19432394; 19139490
19	40902776	nonsynonymous	C	G	0.272727272727273	0	PRX	TRUE	Q9BXM0	reviewed	Periaxin	PRX KIAA1620	5 out of 5	TISSUE SPECIFICITY: Detected in spinal cord (PubMed:11133365). Isoform 1 and isoform 2 are found in sciatic nerve and Schwann cells (PubMed:11157804). {ECO:0000269|PubMed:11133365, ECO:0000269|PubMed:11157804}.	axon ensheathment [GO:0008366]; nerve development [GO:0021675]	DISEASE: Dejerine-Sottas syndrome (DSS) [MIM:145900]: A severe degenerating neuropathy of the demyelinating Charcot-Marie-Tooth disease category, with onset by age 2 years. Characterized by motor and sensory neuropathy with very slow nerve conduction velocities, increased cerebrospinal fluid protein concentrations, hypertrophic nerve changes, delayed age of walking as well as areflexia. There are both autosomal dominant and autosomal recessive forms of Dejerine-Sottas syndrome. {ECO:0000269|PubMed:11133365}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Charcot-Marie-Tooth disease 4F (CMT4F) [MIM:614895]: A recessive demyelinating form of Charcot-Marie-Tooth disease, a disorder of the peripheral nervous system, characterized by progressive weakness and atrophy, initially of the peroneal muscles and later of the distal muscles of the arms. Charcot-Marie-Tooth disease is classified in two main groups on the basis of electrophysiologic properties and histopathology: primary peripheral demyelinating neuropathies (designated CMT1 when they are dominantly inherited) and primary peripheral axonal neuropathies (CMT2). Demyelinating neuropathies are characterized by severely reduced nerve conduction velocities (less than 38 m/sec), segmental demyelination and remyelination with onion bulb formations on nerve biopsy, slowly progressive distal muscle atrophy and weakness, absent deep tendon reflexes, and hollow feet. By convention autosomal recessive forms of demyelinating Charcot-Marie-Tooth disease are designated CMT4. CMT4F is characterized by distal sensory impairment and distal muscle weakness and atrophy affecting the lower more than the upper limbs. The age at onset is variable and can range from childhood to adult years. When the onset is in infancy, the phenotype is characterized as Dejerine-Sottas syndrome. {ECO:0000269|PubMed:22847150}. Note=The disease is caused by mutations affecting the gene represented in this entry.	99952;64748;	11133365; 10997877; 15057824; 15489334; 11157804; 24633211; 24675079; 22847150; 24627108
19	41306555	nonsynonymous	G	C	0.607142857142857	0.5	RAB4B-EGLN2	TRUE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
19	41306555	nonsynonymous	G	C	0.607142857142857	0.5	EGLN2	TRUE	Q96KS0	reviewed	Egl nine homolog 2 (EC 1.14.11.29) (Estrogen-induced tag 6) (HPH-3) (Hypoxia-inducible factor prolyl hydroxylase 1) (HIF-PH1) (HIF-prolyl hydroxylase 1) (HPH-1) (Prolyl hydroxylase domain-containing protein 1) (PHD1)	EGLN2 EIT6	5 out of 5	TISSUE SPECIFICITY: Expressed in adult and fetal heart, brain, liver, lung, skeletal muscle, and kidney. Also expressed in testis and placenta. Highest levels in adult brain, placenta, lung, kidney, and testis. Expressed in hormone responsive tissues, including normal and cancerous mammary, ovarian and prostate epithelium. {ECO:0000269|PubMed:12163023}.	cell redox homeostasis [GO:0045454]; intracellular estrogen receptor signaling pathway [GO:0030520]; peptidyl-proline hydroxylation to 4-hydroxy-L-proline [GO:0018401]; positive regulation of protein catabolic process [GO:0045732]; regulation of cell growth [GO:0001558]; regulation of neuron apoptotic process [GO:0043523]; regulation of transcription from RNA polymerase II promoter in response to hypoxia [GO:0061418]; response to hypoxia [GO:0001666]	NA	NA	11574160; 11850811; 14702039; 17974005; 15057824; 15489334; 11595178; 11595184; 12163023; 12039559; 12181324; 12615973; 15247232; 16509823; 17114296; 19631610; 19339211; 21410436; 22286099; 23932902; 23186163
19	42874895	nonsynonymous	G	A	0.64	1	MEGF8	TRUE	Q7Z7M0	reviewed	Multiple epidermal growth factor-like domains protein 8 (Multiple EGF-like domains protein 8) (Epidermal growth factor-like protein 4) (EGF-like protein 4)	MEGF8 C19orf49 EGFL4 KIAA0817	5 out of 5	NA	BMP signaling pathway [GO:0030509]; cell migration involved in gastrulation [GO:0042074]; coronary vasculature development [GO:0060976]; craniofacial suture morphogenesis [GO:0097094]; determination of digestive tract left/right asymmetry [GO:0071907]; determination of heart left/right asymmetry [GO:0061371]; embryonic heart tube left/right pattern formation [GO:0060971]; embryonic heart tube morphogenesis [GO:0003143]; embryonic limb morphogenesis [GO:0030326]; embryonic skeletal system morphogenesis [GO:0048704]; epiboly involved in gastrulation with mouth forming second [GO:0055113]; fasciculation of sensory neuron axon [GO:0097155]; left/right pattern formation [GO:0060972]; limb morphogenesis [GO:0035108]; positive regulation of axon extension involved in axon guidance [GO:0048842]; regulation of gene expression [GO:0010468]	DISEASE: Carpenter syndrome 2 (CRPT2) [MIM:614976]: An autosomal recessive multiple congenital malformation disorder characterized by multisuture craniosynostosis and polysyndactyly of the hands and feet, in association with abnormal left-right patterning and other features, most commonly obesity, umbilical hernia, cryptorchidism, and congenital heart disease. {ECO:0000269|PubMed:23063620}. Note=The disease is caused by mutations affecting the gene represented in this entry.	65759;	9693030; 15057824; 15489334; 16335952; 23063620
19	44570516	nonsynonymous	G	C	0.347826086956522	0	ZNF223	TRUE	Q9UK11	reviewed	Zinc finger protein 223	ZNF223	4 out of 5	NA	regulation of transcription, DNA-templated [GO:0006355]; transcription, DNA-templated [GO:0006351]	NA	NA	12743021; 14702039; 15057824; 15489334; 8617494; 
19	44892168	nonsynonymous	C	T	0.5	0	ZNF285	TRUE	Q96NJ3	reviewed	Zinc finger protein 285 (Zinc finger protein 285A)	ZNF285 ZNF285A	3 out of 5	NA	regulation of transcription, DNA-templated [GO:0006355]; transcription, DNA-templated [GO:0006351]	NA	NA	14702039; 15057824; 15489334
19	45028231	nonsynonymous	G	A	0.473684210526316	0	CEACAM20	TRUE	Q6UY09	reviewed	Carcinoembryonic antigen-related cell adhesion molecule 20	CEACAM20 UNQ9366/PRO34155	3 out of 5	NA	NA	NA	NA	12975309
19	50097746	nonsynonymous	G	A	0.421052631578947	1	PRR12	TRUE	Q9ULL5	reviewed	Proline-rich protein 12	PRR12 KIAA1205	2 out of 5	NA	NA	NA	NA	10574462; 15057824; 10737800; 15489334; 17081983; 18220336; 18669648; 19413330; 19690332; 19608861; 20068231; 21406692; 23186163; 24275569
19	55993436	nonsynonymous	G	T	0.35	1	ZNF628	TRUE	Q5EBL2	reviewed	Zinc finger protein 628	ZNF628	3 out of 5	NA	regulation of transcription, DNA-templated [GO:0006355]; transcription, DNA-templated [GO:0006351]	NA	NA	15057824; 15489334; 23186163
19	57036362	nonsynonymous	A	G	0.576923076923077	0	ZNF471	TRUE	Q9BX82	reviewed	Zinc finger protein 471 (EZFIT-related protein 1)	ZNF471 ERP1 KIAA1396	4 out of 5	NA	regulation of transcription, DNA-templated [GO:0006355]; transcription, DNA-templated [GO:0006351]	NA	NA	14702039; 17974005; 15057824; 15489334; 10718198; 16959974
20	1115619	nonsynonymous	C	T	0.344827586206897	1	PSMF1	FALSE	Q92530	reviewed	Proteasome inhibitor PI31 subunit (hPI31)	PSMF1	5 out of 5	NA	anaphase-promoting complex-dependent catabolic process [GO:0031145]; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent [GO:0002479]; Fc-epsilon receptor signaling pathway [GO:0038095]; MAPK cascade [GO:0000165]; negative regulation of canonical Wnt signaling pathway [GO:0090090]; negative regulation of proteasomal protein catabolic process [GO:1901799]; negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle [GO:0051436]; NIK/NF-kappaB signaling [GO:0038061]; positive regulation of canonical Wnt signaling pathway [GO:0090263]; positive regulation of ubiquitin-protein ligase activity involved in regulation of mitotic cell cycle transition [GO:0051437]; proteasome-mediated ubiquitin-dependent protein catabolic process [GO:0043161]; protein polyubiquitination [GO:0000209]; regulation of cellular amino acid metabolic process [GO:0006521]; regulation of mRNA stability [GO:0043488]; stimulatory C-type lectin receptor signaling pathway [GO:0002223]; T cell receptor signaling pathway [GO:0050852]; tumor necrosis factor-mediated signaling pathway [GO:0033209]; ubiquitin-dependent protein catabolic process [GO:0006511]; Wnt signaling pathway, planar cell polarity pathway [GO:0060071]	NA	NA	10764772; 11780052; 15489334; 18669648; 19690332; 20068231; 21269460; 21406692; 22223895; 23186163; 24275569; 25944712; 18495667
20	35766232	nonsynonymous	G	A	0.45	1	MROH8	TRUE	Q9H579	reviewed	Protein MROH8 (Maestro heat-like repeat-containing protein family member 8)	MROH8 C20orf131 C20orf132	2 out of 5	NA	NA	NA	NA	14702039; 11780052; 17974005
20	47558417	nonsynonymous	C	T	0.523809523809524	1	ARFGEF2	TRUE	Q9Y6D5	reviewed	Brefeldin A-inhibited guanine nucleotide-exchange protein 2 (Brefeldin A-inhibited GEP 2) (ADP-ribosylation factor guanine nucleotide-exchange factor 2)	ARFGEF2 ARFGEP2 BIG2	5 out of 5	TISSUE SPECIFICITY: Expressed in placenta, lung, heart, brain, kidney and pancreas.	endomembrane system organization [GO:0010256]; endosome organization [GO:0007032]; exocytosis [GO:0006887]; Golgi to plasma membrane transport [GO:0006893]; intracellular signal transduction [GO:0035556]; positive regulation of tumor necrosis factor production [GO:0032760]; protein transport [GO:0015031]; receptor recycling [GO:0001881]; regulation of ARF protein signal transduction [GO:0032012]	DISEASE: Periventricular nodular heterotopia 2 (PVNH2) [MIM:608097]: A developmental disorder characterized by the presence of periventricular nodules of cerebral gray matter, resulting from a failure of neurons to migrate normally from the lateral ventricular proliferative zone, where they are formed, to the cerebral cortex. PVNH2 is an autosomal recessive form characterized by microcephaly (small brain), severe developmental delay and recurrent infections. No anomalies extrinsic to the central nervous system, such as dysmorphic features or grossly abnormal endocrine or other conditions, are associated with PVNH2. {ECO:0000269|PubMed:14647276}. Note=The disease is caused by mutations affecting the gene represented in this entry.	98892;	10212200; 11780052; 10716990; 12051703; 12571360; 15385626; 15705715; 17081983; 16866877; 16477018; 17276987; 17640864; 17360629; 18625701; 18691976; 18669648; 19413330; 19369195; 19332778; 19690332; 20360857; 20068231; 21269460; 21406692; 22814378; 23186163; 24275569; 14647276; 16959974; 23033978
20	62250651	nonsynonymous	C	T	0.444444444444444	1	GMEB2	TRUE	Q9UKD1	reviewed	Glucocorticoid modulatory element-binding protein 2 (GMEB-2) (DNA-binding protein p79PIF) (Parvovirus initiation factor p79) (PIF p79)	GMEB2 KIAA1269	5 out of 5	TISSUE SPECIFICITY: Expressed in peripheral blood lymphocytes and fetal liver. Expressed preferentially in reproductive and/or developmentally important cells, such as testis, placenta, bone marrow and fetal tissues.	regulation of transcription from RNA polymerase II promoter [GO:0006357]; transcription from RNA polymerase II promoter [GO:0006366]	NA	NA	10523663; 10574462; 11780052; 15489334; 17974005; 19690332; 24275569; 25114211
21	30963448	nonsynonymous	A	G	0.6	1	GRIK1	TRUE	P39086	reviewed	Glutamate receptor ionotropic, kainate 1 (GluK1) (Excitatory amino acid receptor 3) (EAA3) (Glutamate receptor 5) (GluR-5) (GluR5)	GRIK1 GLUR5	5 out of 5	TISSUE SPECIFICITY: Most abundant in the cerebellum and the suprachiasmatic nuclei (SCN) of the hypothalamus.	central nervous system development [GO:0007417]; glutamate receptor signaling pathway [GO:0007215]; nervous system development [GO:0007399]; regulation of synaptic transmission, glutamatergic [GO:0051966]; synaptic transmission [GO:0007268]; transport [GO:0006810]	NA	NA	8260617; 8589992; 7696618; 11702055
21	41137503	nonsynonymous	G	A	0.666666666666667	0	IGSF5	TRUE	Q9NSI5	reviewed	Immunoglobulin superfamily member 5 (IgSF5) (Junctional adhesion molecule 4) (JAM-4)	IGSF5 JAM4	4 out of 5	NA	single organismal cell-cell adhesion [GO:0016337]	NA	NA	14702039; 10830953; 22042635
21	46309312	nonsynonymous	G	A	0.24	0	ITGB2	TRUE	P05107	reviewed	Integrin beta-2 (Cell surface adhesion glycoproteins LFA-1/CR3/p150,95 subunit beta) (Complement receptor C3 subunit beta) (CD antigen CD18)	ITGB2 CD18 MFI7	5 out of 5	TISSUE SPECIFICITY: Leukocytes. {ECO:0000269|PubMed:23775590}.	aging [GO:0007568]; apoptotic process [GO:0006915]; cell adhesion [GO:0007155]; cell-cell signaling [GO:0007267]; cell-matrix adhesion [GO:0007160]; cellular extravasation [GO:0045123]; cellular response to low-density lipoprotein particle stimulus [GO:0071404]; endodermal cell differentiation [GO:0035987]; endothelial cell migration [GO:0043542]; extracellular matrix organization [GO:0030198]; heterotypic cell-cell adhesion [GO:0034113]; inflammatory response [GO:0006954]; integrin-mediated signaling pathway [GO:0007229]; leukocyte cell-cell adhesion [GO:0007159]; leukocyte migration [GO:0050900]; leukocyte migration involved in inflammatory response [GO:0002523]; natural killer cell activation [GO:0030101]; neutrophil chemotaxis [GO:0030593]; positive regulation of angiogenesis [GO:0045766]; positive regulation of NF-kappaB transcription factor activity [GO:0051092]; positive regulation of nitric oxide biosynthetic process [GO:0045429]; receptor clustering [GO:0043113]; receptor internalization [GO:0031623]; regulation of cell shape [GO:0008360]; regulation of immune response [GO:0050776]; regulation of peptidyl-tyrosine phosphorylation [GO:0050730]; toll-like receptor 4 signaling pathway [GO:0034142]	DISEASE: Leukocyte adhesion deficiency 1 (LAD1) [MIM:116920]: LAD1 patients have recurrent bacterial infections and their leukocytes are deficient in a wide range of adhesion-dependent functions. {ECO:0000269|PubMed:1346613, ECO:0000269|PubMed:1347532, ECO:0000269|PubMed:1352501, ECO:0000269|PubMed:1590804, ECO:0000269|PubMed:1694220, ECO:0000269|PubMed:1968911, ECO:0000269|PubMed:20529581, ECO:0000269|PubMed:20549317, ECO:0000269|PubMed:7509236, ECO:0000269|PubMed:7686755, ECO:0000269|PubMed:9884339}. Note=The disease is caused by mutations affecting the gene represented in this entry.	99842;	3028646; 1683838; 14702039; 10830953; 15489334; 2954816; 7509236; 1346613; 10766246; 11700305; 11812992; 14722085; 15356110; 16301335; 16335952; 18587400; 19828450; 19159218; 19349973; 23775590; 25944712; 27055590; 20033057; 1968911; 1694220; 1590804; 1352501; 1347532; 7686755; 9884339; 20529581; 20549317
22	20705118	nonsynonymous	A	G	0.538461538461538	0	LOC101927859	FALSE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
22	21383429	nonsynonymous	A	T	0.5	1	SLC7A4	TRUE	O43246	reviewed	Cationic amino acid transporter 4 (CAT-4) (CAT4) (Solute carrier family 7 member 4)	SLC7A4	4 out of 5	NA	cellular amino acid metabolic process [GO:0006520]; transport [GO:0006810]	NA	NA	9598310; 15461802; 15489334
22	32756460	nonsynonymous	G	C	0.444444444444444	1	RFPL3	TRUE	O75679	reviewed	Ret finger protein-like 3	RFPL3	3 out of 5	NA	NA	NA	NA	10508838; 15461802; 10591208; 15489334
22	32756460	nonsynonymous	G	C	0.444444444444444	1	RFPL3S	TRUE	P0C7P2	reviewed	Putative protein RFPL3S (RFPL3 antisense RNA 1) (RFPL3 antisense gene protein 1) (Ret finger protein-like 3 antisense gene protein)	RFPL3S RFPL3-AS1	2 out of 5	TISSUE SPECIFICITY: Strongly expressed in the testis and weakly in brain, placenta and pancreas. {ECO:0000269|PubMed:10508838}.	NA	NA	NA	10508838; 15461802; 10591208
22	33673125	nonsynonymous	C	T	0.457142857142857	1	LARGE1	TRUE	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA
22	36122724	nonsynonymous	C	A	0.357142857142857	0.3	APOL5	TRUE	Q9BWW9	reviewed	Apolipoprotein L5 (Apolipoprotein L-V) (ApoL-V)	APOL5	3 out of 5	TISSUE SPECIFICITY: Low level of expression; detected in uterus, testis, skeletal muscle and stomach.	lipid metabolic process [GO:0006629]; lipid transport [GO:0006869]; lipoprotein metabolic process [GO:0042157]	NA	NA	11374903; 10591208
22	38221032	nonsynonymous	C	T	0.347826086956522	1	GALR3	TRUE	O60755	reviewed	Galanin receptor type 3 (GAL3-R) (GALR-3)	GALR3 GALNR3	5 out of 5	NA	adenylate cyclase-modulating G-protein coupled receptor signaling pathway [GO:0007188]; feeding behavior [GO:0007631]; learning or memory [GO:0007611]; negative regulation of adenylate cyclase activity [GO:0007194]; neuropeptide signaling pathway [GO:0007218]; phospholipase C-activating G-protein coupled receptor signaling pathway [GO:0007200]; positive regulation of transcription from RNA polymerase II promoter [GO:0045944]; synaptic transmission [GO:0007268]	NA	NA	9722565; 9832121; 9928159; 10591208; 24517231; 25691535
22	39003414	nonsynonymous	C	T	0.476190476190476	0	FAM227A	TRUE	F5H4B4	reviewed	Protein FAM227A	FAM227A	2 out of 5	NA	NA	NA	NA	14702039; 10591208; 18669648
22	40661112	nonsynonymous	T	C	0.347826086956522	1	TNRC6B	FALSE	Q9UPQ9	reviewed	Trinucleotide repeat-containing gene 6B protein	TNRC6B KIAA1093	5 out of 5	NA	gene silencing by RNA [GO:0031047]; phosphatidylinositol-mediated signaling [GO:0048015]; positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay [GO:1900153]; positive regulation of nuclear-transcribed mRNA poly(A) tail shortening [GO:0060213]; posttranscriptional gene silencing by RNA [GO:0035194]; regulation of translation [GO:0006417]; Wnt signaling pathway, calcium modulating pathway [GO:0007223]	NA	NA	10470851; 12168954; 14702039; 10591208; 15489334; 16289642; 18690212; 18669648; 19167051; 19304925; 19383768; 19690332; 20068231; 21269460; 21981923; 21984185; 21406692; 23186163; 24275569
22	45279003	nonsynonymous	G	A	0.545454545454545	1	PHF21B	TRUE	Q96EK2	reviewed	PHD finger protein 21B	PHF21B KIAA1661	3 out of 5	NA	regulation of transcription, DNA-templated [GO:0006355]	NA	NA	15461802; 14702039; 10591208; 15489334
X	134986656	nonsynonymous	A	G	1	0	SAGE1	TRUE	Q9NXZ1	reviewed	Sarcoma antigen 1 (Cancer/testis antigen 14) (CT14)	SAGE1 SAGE	2 out of 5	TISSUE SPECIFICITY: Expressed mainly in bladder, lung, head and neck carcinomas. Not expressed in normal tissues except for testis. {ECO:0000269|PubMed:10919659}.	NA	NA	NA	10919659; 15772651; 18669648; 23186163
